NM_000089.4:c.2350-124_2350-87dupACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000089.4(COL1A2):c.2350-124_2350-87dupACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000089.4 intron
Scores
Clinical Significance
Conservation
Publications
- COL1A2-related Ehlers-Danlos syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- COL1A2-related osteogenesis imperfectaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- Ehlers-Danlos syndrome, arthrochalasia typeInheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- Ehlers-Danlos syndrome, arthrochalasia type, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Illumina, PanelApp Australia, Labcorp Genetics (formerly Invitae)
- osteogenesis imperfectaInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- osteogenesis imperfecta type 1Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- osteogenesis imperfecta type 2Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet
- osteogenesis imperfecta type 3Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
- osteogenesis imperfecta type 4Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Ehlers-Danlos syndrome, cardiac valvular typeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, PanelApp Australia, Orphanet, G2P, ClinGen
- combined osteogenesis imperfecta and Ehlers-Danlos syndrome 2Inheritance: AD Classification: MODERATE Submitted by: ClinGen, Ambry Genetics
- Ehlers-Danlos/osteogenesis imperfecta syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- high bone mass osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- congenital heart diseaseInheritance: Unknown Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000089.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL1A2 | NM_000089.4 | MANE Select | c.2350-124_2350-87dupACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT | intron | N/A | NP_000080.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL1A2 | ENST00000297268.11 | TSL:1 MANE Select | c.2350-127_2350-126insCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA | intron | N/A | ENSP00000297268.6 | P08123 | ||
| COL1A2 | ENST00000959377.1 | c.2350-127_2350-126insCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA | intron | N/A | ENSP00000629436.1 | ||||
| COL1A2 | ENST00000959379.1 | c.2350-127_2350-126insCTACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTA | intron | N/A | ENSP00000629438.1 |
Frequencies
GnomAD3 genomes Cov.: 24
GnomAD4 genome Cov.: 24
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at