7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_005222.4(DLX6):c.78_98dupGCAGCAGCAGCAGCAGCAGCA(p.Gln27_Gln33dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000126 in 1,582,054 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q33Q) has been classified as Likely benign.
Frequency
Consequence
NM_005222.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005222.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DLX6 | NM_005222.4 | MANE Select | c.78_98dupGCAGCAGCAGCAGCAGCAGCA | p.Gln27_Gln33dup | disruptive_inframe_insertion | Exon 1 of 3 | NP_005213.3 | ||
| DLX6-AS1 | NR_015448.1 | n.141+7853_141+7873dupTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DLX6 | ENST00000518156.3 | TSL:1 MANE Select | c.78_98dupGCAGCAGCAGCAGCAGCAGCA | p.Gln27_Gln33dup | disruptive_inframe_insertion | Exon 1 of 3 | ENSP00000428480.2 | P56179-3 | |
| DLX6-AS1 | ENST00000458352.5 | TSL:1 | n.615+5753_615+5773dupTGCTGCTGCTGCTGCTGCTGC | intron | N/A | ||||
| DLX6-AS1 | ENST00000430027.3 | TSL:2 | n.141+7853_141+7873dupTGCTGCTGCTGCTGCTGCTGC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.00000666 AC: 1AN: 150048Hom.: 0 Cov.: 29 show subpopulations
GnomAD4 exome AF: 6.98e-7 AC: 1AN: 1432006Hom.: 0 Cov.: 34 AF XY: 0.00000141 AC XY: 1AN XY: 710120 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.00000666 AC: 1AN: 150048Hom.: 0 Cov.: 29 AF XY: 0.0000137 AC XY: 1AN XY: 73220 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at