rs530625473

Variant names:

• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-G
• rs530625473
• NM_005222.4:c.78_98delGCAGCAGCAGCAGCAGCAGCA

Your query was ambiguous. Multiple possible variants found:

• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-G
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• chr7-97006051-GGCAGCAGCAGCAGCAGCAGCA-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_005222.4(DLX6):​c.78_98delGCAGCAGCAGCAGCAGCAGCA​(p.Gln27_Gln33del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000759 in 1,582,052 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 29)
  • Exomes 𝑓: 0.0000070 (0 hom.)
• Consequence: DLX6 NM_005222.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.66
• Publications: 0 publications found

Genes affected

DLX6 (HGNC:2919): (distal-less homeobox 6) This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]

DLX6-AS1 (HGNC:37151): (DLX6 antisense RNA 1) Predicted to act upstream of or within positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_005222.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005222.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DLX6	NM_005222.4	MANE Select	c.78_98delGCAGCAGCAGCAGCAGCAGCA	p.Gln27_Gln33del	disruptive_inframe_deletion	Exon 1 of 3	NP_005213.3
	DLX6-AS1	NR_015448.1		n.141+7853_141+7873delTGCTGCTGCTGCTGCTGCTGC		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DLX6	ENST00000518156.3	TSL:1 MANE Select	c.78_98delGCAGCAGCAGCAGCAGCAGCA	p.Gln27_Gln33del	disruptive_inframe_deletion	Exon 1 of 3	ENSP00000428480.2	P56179-3
	DLX6-AS1	ENST00000458352.5	TSL:1	n.615+5753_615+5773delTGCTGCTGCTGCTGCTGCTGC		intron	N/A
	DLX6-AS1	ENST00000430027.3	TSL:2	n.141+7853_141+7873delTGCTGCTGCTGCTGCTGCTGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.0000133 AC: 2 AN: 150048 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.000485

GnomAD4 exome AF: 0.00000698 AC: 10 AN: 1432004 Hom.: 0 AF XY: 0.00000986 AC XY: 7 AN XY: 710120

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32742

American (AMR) AF: 0.00 AC: 0 AN: 41158

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25642

East Asian (EAS) AF: 0.00 AC: 0 AN: 38222

South Asian (SAS) AF: 0.0000122 AC: 1 AN: 81960

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49986

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5722

European-Non Finnish (NFE) AF: 0.00000729 AC: 8 AN: 1097402

Other (OTH) AF: 0.0000169 AC: 1 AN: 59170

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000951843), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000133 AC: 2 AN: 150048 Hom.: 0 Cov.: 29 AF XY: 0.0000273 AC XY: 2 AN XY: 73220

African (AFR) AF: 0.00 AC: 0 AN: 40956

American (AMR) AF: 0.00 AC: 0 AN: 15084

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3450

East Asian (EAS) AF: 0.00 AC: 0 AN: 5074

South Asian (SAS) AF: 0.00 AC: 0 AN: 4760

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10066

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 304

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67382

Other (OTH) AF: 0.000485 AC: 1 AN: 2060

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.7
Mutation Taster		=66/134	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs530625473; hg19: chr7-96635363;