7-97006052-G-GCAGCAGCAGCAGCAGCAGCAGCAA
Variant summary
Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP3BP6BS2
The NM_005222.4(DLX6):c.105_128dupGCAGCAGCAGCAGCAGCAACAGCA(p.Gln36_Gln43dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.000452 in 1,531,450 control chromosomes in the GnomAD database, including 2 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_005222.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
DLX6 | NM_005222.4 | c.105_128dupGCAGCAGCAGCAGCAGCAACAGCA | p.Gln36_Gln43dup | disruptive_inframe_insertion | Exon 1 of 3 | ENST00000518156.3 | NP_005213.3 | |
DLX6-AS1 | NR_015448.1 | n.141+7849_141+7872dupTTGCTGCTGCTGCTGCTGCTGCTG | intron_variant | Intron 1 of 2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000617 AC: 92AN: 149216Hom.: 0 Cov.: 29
GnomAD3 exomes AF: 0.0000761 AC: 13AN: 170816Hom.: 0 AF XY: 0.0000860 AC XY: 8AN XY: 93028
GnomAD4 exome AF: 0.000434 AC: 600AN: 1382132Hom.: 2 Cov.: 34 AF XY: 0.000440 AC XY: 301AN XY: 683468
GnomAD4 genome AF: 0.000616 AC: 92AN: 149318Hom.: 0 Cov.: 29 AF XY: 0.000494 AC XY: 36AN XY: 72940
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.105_128dup, results in the insertion of 8 amino acid(s) of the DLX6 protein (p.Gln37_Gln44dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with DLX6-related conditions. ClinVar contains an entry for this variant (Variation ID: 1301676). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not specified Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at