7-97006052-G-GCAGCAGCAGCAGCAGCAGCAGCAA

Variant names:

• chr7-97006052-G-GCAGCAGCAGCAGCAGCAGCAGCAA
• rs775320932
• NM_005222.4:c.105_128dupGCAGCAGCAGCAGCAGCAACAGCA

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP3 BP6 BS2

The NM_005222.4(DLX6):​c.105_128dupGCAGCAGCAGCAGCAGCAACAGCA​(p.Gln36_Gln43dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.000452 in 1,531,450 control chromosomes in the GnomAD database, including 2 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00062 (0 hom., cov: 29)
  • Exomes 𝑓: 0.00043 (2 hom.)
• Consequence: DLX6 NM_005222.4 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: 4.05

Genes affected

DLX6 (HGNC:2919): (distal-less homeobox 6) This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]

DLX6-AS1 (HGNC:37151): (DLX6 antisense RNA 1) Predicted to act upstream of or within positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_005222.4
• BP6: Variant 7-97006052-G-GCAGCAGCAGCAGCAGCAGCAGCAA is Benign according to our data. Variant chr7-97006052-G-GCAGCAGCAGCAGCAGCAGCAGCAA is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 1301676.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Uncertain_significance=1}.
• BS2: High AC in GnomAd4 at 92 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DLX6	NM_005222.4	c.105_128dupGCAGCAGCAGCAGCAGCAACAGCA	p.Gln36_Gln43dup	disruptive_inframe_insertion	Exon 1 of 3	ENST00000518156.3	NP_005213.3
DLX6-AS1	NR_015448.1	n.141+7849_141+7872dupTTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DLX6	ENST00000518156.3	c.105_128dupGCAGCAGCAGCAGCAGCAACAGCA	p.Gln36_Gln43dup	disruptive_inframe_insertion	Exon 1 of 3	1	NM_005222.4	ENSP00000428480.2

Frequencies

GnomAD3 genomes AF: 0.000617 AC: 92 AN: 149216 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.000396

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000266

Gnomad ASJ AF: 0.000290

Gnomad EAS AF: 0.00160

Gnomad SAS AF: 0.000421

Gnomad FIN AF: 0.000795

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000788

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000761 AC: 13 AN: 170816 Hom.: 0 AF XY: 0.0000860 AC XY: 8 AN XY: 93028

Gnomad AFR exome AF: 0.000241

Gnomad AMR exome AF: 0.0000757

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000166

Gnomad SAS exome AF: 0.000127

Gnomad FIN exome AF: 0.000125

Gnomad NFE exome AF: 0.0000281

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000434 AC: 600 AN: 1382132 Hom.: 2 Cov.: 34 AF XY: 0.000440 AC XY: 301 AN XY: 683468

Gnomad4 AFR exome AF: 0.000161

Gnomad4 AMR exome AF: 0.000352

Gnomad4 ASJ exome AF: 0.0000813

Gnomad4 EAS exome AF: 0.000684

Gnomad4 SAS exome AF: 0.000503

Gnomad4 FIN exome AF: 0.00149

Gnomad4 NFE exome AF: 0.000383

Gnomad4 OTH exome AF: 0.000649

GnomAD4 genome AF: 0.000616 AC: 92 AN: 149318 Hom.: 0 Cov.: 29 AF XY: 0.000494 AC XY: 36 AN XY: 72940

Gnomad4 AFR AF: 0.000395

Gnomad4 AMR AF: 0.000266

Gnomad4 ASJ AF: 0.000290

Gnomad4 EAS AF: 0.00161

Gnomad4 SAS AF: 0.000421

Gnomad4 FIN AF: 0.000795

Gnomad4 NFE AF: 0.000788

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1

Jan 06, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.105_128dup, results in the insertion of 8 amino acid(s) of the DLX6 protein (p.Gln37_Gln44dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with DLX6-related conditions. ClinVar contains an entry for this variant (Variation ID: 1301676). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not specified Benign:1

Jan 02, 2020

Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs775320932; hg19: chr7-96635364;