8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G

Position:

• chr8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G

Variant summary

Our verdict is Pathogenic. Variant got 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000497.4(CYP11B1):​c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC​(p.Leu106fs) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000527 in 1,614,052 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000055 (0 hom.)
• Consequence: CYP11B1 NM_000497.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 6.38

Genes affected

CYP11B1 (HGNC:2591): (cytochrome P450 family 11 subfamily B member 1) This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]

GML (HGNC:4375): (glycosylphosphatidylinositol anchored molecule like) Predicted to be involved in DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; apoptotic process; and negative regulation of cell population proliferation. Predicted to be extrinsic component of membrane. [provided by Alliance of Genome Resources, Apr 2022]

CYP11B1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G is Pathogenic according to our data. Variant chr8-142879082-GGGCTCCAGGCTCATCCTGTGGGGATGCA-G is described in ClinVar as [Pathogenic]. Clinvar id is 551876.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CYP11B1	NM_000497.4	c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC	p.Leu106fs	frameshift_variant	2/9	ENST00000292427.10	NP_000488.3
CYP11B1	NM_001026213.1	c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC	p.Leu106fs	frameshift_variant	2/8		NP_001021384.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CYP11B1	ENST00000292427.10	c.317_344delTGCATCCCCACAGGATGAGCCTGGAGCC	p.Leu106fs	frameshift_variant	2/9	1	NM_000497.4	ENSP00000292427.5

Frequencies

GnomAD3 genomes AF: 0.0000329 AC: 5 AN: 152164 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000735

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00000795 AC: 2 AN: 251440 Hom.: 0 AF XY: 0.00000736 AC XY: 1 AN XY: 135892

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000547 AC: 80 AN: 1461888 Hom.: 0 AF XY: 0.0000536 AC XY: 39 AN XY: 727244

Gnomad4 AFR exome AF: 0.0000299

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000692

Gnomad4 OTH exome AF: 0.0000331

GnomAD4 genome AF: 0.0000329 AC: 5 AN: 152164 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74326

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000735

Gnomad4 OTH AF: 0.00

Alfa AF: 0.0000843 Hom.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Deficiency of steroid 11-beta-monooxygenase Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Baylor Genetics	Mar 25, 2024	- -
Pathogenic, criteria provided, single submitter	clinical testing	Counsyl	May 10, 2017	- -

Deficiency of steroid 11-beta-monooxygenase;C3838731:Glucocorticoid-remediable aldosteronism Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Feb 13, 2024

- -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 14, 2023

This sequence change creates a premature translational stop signal (p.Leu106Profs*18) in the CYP11B1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CYP11B1 are known to be pathogenic (PMID: 8506298, 26476331). This variant is present in population databases (rs764418169, gnomAD 0.002%). This premature translational stop signal has been observed in individual(s) with congenital adrenal hyperplasia (PMID: 28228528). ClinVar contains an entry for this variant (Variation ID: 551876). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs764418169; hg19: chr8-143960498;