8-143213623-TAGGACAGTGAGTAGGGTGAGTAGGCTGC-T

Position:

• chr8-143213623-TAGGACAGTGAGTAGGGTGAGTAGGCTGC-T

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_178172.6(GPIHBP1):​c.53-174_53-147delCTGCAGGACAGTGAGTAGGGTGAGTAGG variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Benign (★).

• Frequency: Genomes: 𝑓 0.19 (917 hom., cov: 0)
• Consequence: GPIHBP1 NM_178172.6 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.53

Genes affected

GPIHBP1 (HGNC:24945): (glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1) This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 8-143213623-TAGGACAGTGAGTAGGGTGAGTAGGCTGC-T is Benign according to our data. Variant chr8-143213623-TAGGACAGTGAGTAGGGTGAGTAGGCTGC-T is described in ClinVar as [Benign]. Clinvar id is 1260178.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr8-143213623-TAGGACAGTGAGTAGGGTGAGTAGGCTGC-T is described in Lovd as [Benign].
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.253 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
GPIHBP1	NM_178172.6	c.53-174_53-147delCTGCAGGACAGTGAGTAGGGTGAGTAGG		intron_variant		ENST00000622500.2	NP_835466.2
GPIHBP1	NM_001301772.2	c.53-174_53-147delCTGCAGGACAGTGAGTAGGGTGAGTAGG		intron_variant			NP_001288701.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
GPIHBP1	ENST00000622500.2	c.53-174_53-147delCTGCAGGACAGTGAGTAGGGTGAGTAGG		intron_variant		1	NM_178172.6	ENSP00000480053.1

Frequencies

GnomAD3 genomes AF: 0.192 AC: 15370 AN: 79848 Hom.: 917 Cov.: 0

Gnomad AFR AF: 0.0839

Gnomad AMI AF: 0.269

Gnomad AMR AF: 0.211

Gnomad ASJ AF: 0.263

Gnomad EAS AF: 0.128

Gnomad SAS AF: 0.218

Gnomad FIN AF: 0.302

Gnomad MID AF: 0.148

Gnomad NFE AF: 0.258

Gnomad OTH AF: 0.219

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.192 AC: 15375 AN: 79892 Hom.: 917 Cov.: 0 AF XY: 0.195 AC XY: 7697 AN XY: 39426

Gnomad4 AFR AF: 0.0840

Gnomad4 AMR AF: 0.211

Gnomad4 ASJ AF: 0.263

Gnomad4 EAS AF: 0.128

Gnomad4 SAS AF: 0.219

Gnomad4 FIN AF: 0.302

Gnomad4 NFE AF: 0.258

Gnomad4 OTH AF: 0.215

Alfa AF: 0.118 Hom.: 280

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Nov 18, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs528789553; hg19: chr8-144295498;