8-144517750-T-TGCAGCCGCTCCCGCACGTCCC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_004260.4(RECQL4):c.14_34dupGGGACGTGCGGGAGCGGCTGC(p.Arg5_Leu11dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,328,334 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_004260.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004260.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RECQL4 | MANE Select | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 21 | NP_004251.4 | O94761 | ||
| RECQL4 | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 20 | NP_001399948.1 | ||||
| RECQL4 | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 21 | NP_001399965.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RECQL4 | TSL:1 MANE Select | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 21 | ENSP00000482313.2 | O94761 | ||
| RECQL4 | TSL:1 | c.-1123_-1103dupGGGACGTGCGGGAGCGGCTGC | 5_prime_UTR | Exon 1 of 20 | ENSP00000483145.1 | A0A087X072 | |||
| RECQL4 | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 21 | ENSP00000641769.1 |
Frequencies
GnomAD3 genomes AF: 0.0000332 AC: 5AN: 150744Hom.: 0 Cov.: 34 show subpopulations
GnomAD4 exome AF: 0.0000153 AC: 18AN: 1177590Hom.: 0 Cov.: 32 AF XY: 0.0000157 AC XY: 9AN XY: 574190 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000332 AC: 5AN: 150744Hom.: 0 Cov.: 34 AF XY: 0.0000544 AC XY: 4AN XY: 73574 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at