NM_004260.4:c.14_34dupGGGACGTGCGGGAGCGGCTGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_004260.4(RECQL4):c.14_34dupGGGACGTGCGGGAGCGGCTGC(p.Arg5_Leu11dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000173 in 1,328,334 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_004260.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RECQL4 | NM_004260.4 | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 21 | ENST00000617875.6 | NP_004251.4 | |
LRRC14 | NM_014665.4 | c.-403_-402insGCAGCCGCTCCCGCACGTCCC | upstream_gene_variant | ENST00000292524.6 | NP_055480.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RECQL4 | ENST00000617875.6 | c.14_34dupGGGACGTGCGGGAGCGGCTGC | p.Arg5_Leu11dup | conservative_inframe_insertion | Exon 1 of 21 | 1 | NM_004260.4 | ENSP00000482313.2 | ||
LRRC14 | ENST00000292524.6 | c.-403_-402insGCAGCCGCTCCCGCACGTCCC | upstream_gene_variant | 1 | NM_014665.4 | ENSP00000292524.1 |
Frequencies
GnomAD3 genomes AF: 0.0000332 AC: 5AN: 150744Hom.: 0 Cov.: 34
GnomAD4 exome AF: 0.0000153 AC: 18AN: 1177590Hom.: 0 Cov.: 32 AF XY: 0.0000157 AC XY: 9AN XY: 574190
GnomAD4 genome AF: 0.0000332 AC: 5AN: 150744Hom.: 0 Cov.: 34 AF XY: 0.0000544 AC XY: 4AN XY: 73574
ClinVar
Submissions by phenotype
Baller-Gerold syndrome Uncertain:1
This variant, c.14_34dup, is a complex sequence change that results in the duplication of 7 amino acid(s) in the RECQL4 protein (p.Arg5_Leu11dup). This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with RECQL4-related conditions. ClinVar contains an entry for this variant (Variation ID: 528928). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at