9-104831739-CAGAACTTCCTCTCA-CGTACAGTGGCGTGACCTCAGCTCACTGCAACCTCTGCCTCCTGAGTTCAAGTGATTCTCGTGCCTCAGCCTCCCAAGTAGCTGGGATT

Position:

• chr9-104831739-CAGAACTTCCTCTCA-CGTACAGTGGCGTGACCTCAGCTCACTGCAACCTCTGCCTCCTGAGTTCAAGTGATTCTCGTGCCTCAGCCTCCCAAGTAGCTGGGATT

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_005502.4(ABCA1):​c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC​(p.Asp528fs) variant causes a frameshift, stop gained, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCA1 NM_005502.4 frameshift, stop_gained, missense
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.95

Genes affected

ABCA1 (HGNC:29): (ATP binding cassette subfamily A member 1) The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in both alleles of this gene cause Tangier disease and familial high-density lipoprotein (HDL) deficiency. [provided by RefSeq, Sep 2019]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ABCA1	NM_005502.4	c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC	p.Asp528fs	frameshift_variant, stop_gained, missense_variant	13/50	ENST00000374736.8	NP_005493.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ABCA1	ENST00000374736.8	c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC	p.Asp528fs	frameshift_variant, stop_gained, missense_variant	13/50	1	NM_005502.4	ENSP00000363868.3
ABCA1	ENST00000678995.1	c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC	p.Asp528fs	frameshift_variant, stop_gained, missense_variant	13/50			ENSP00000504612.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs796051873; hg19: chr9-107594021;