rs796051873

Variant names:

• chr9-104831740-AGAACTTCCTCTCA-GTACAGTGGCGTGACCTCAGCTCACTGCAACCTCTGCCTCCTGAGTTCAAGTGATTCTCGTGCCTCAGCCTCCCAAGTAGCTGGGATT
• rs796051873
• NM_005502.4:c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC

Your query was ambiguous. Multiple possible variants found:

• chr9-104831739-CAGAACTTCCTCTCA-CGTACAGTGGCGTGACCTCAGCTCACTGCAACCTCTGCCTCCTGAGTTCAAGTGATTCTCGTGCCTCAGCCTCCCAAGTAGCTGGGATT
• chr9-104831739-CAGAACTTCCTCTCA-CGTACAGTGGCGTGACCTCAGCTCACTGCAACCTCTGCCTCCTGAGTTCAAGTGATTCTCGTGCCTCAGCCTCCCAAGTAGCTGGGATTACAGCTCCTGCCACCACGCCCG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_005502.4(ABCA1):​c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC​(p.Asp528GlufsTer23) variant causes a frameshift, stop gained, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCA1 NM_005502.4 frameshift, stop_gained, missense
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.95
• Publications: 0 publications found

Genes affected

ABCA1 (HGNC:29): (ATP binding cassette subfamily A member 1) The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in both alleles of this gene cause Tangier disease and familial high-density lipoprotein (HDL) deficiency. [provided by RefSeq, Sep 2019]

ABCA1 Gene-Disease associations (from GenCC):

• hypoalphalipoproteinemia, primary, 1

  Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• Tangier disease

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet
• apolipoprotein A-I deficiency

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ABCA1	NM_005502.4	c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC	p.Asp528GlufsTer23	frameshift_variant, stop_gained, missense_variant	Exon 13 of 50	ENST00000374736.8	NP_005493.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ABCA1	ENST00000374736.8	c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC	p.Asp528GlufsTer23	frameshift_variant, stop_gained, missense_variant	Exon 13 of 50	1	NM_005502.4	ENSP00000363868.3
ABCA1	ENST00000678995.1	c.1584_1597delTGAGAGGAAGTTCTinsAATCCCAGCTACTTGGGAGGCTGAGGCACGAGAATCACTTGAACTCAGGAGGCAGAGGTTGCAGTGAGCTGAGGTCACGCCACTGTAC	p.Asp528GlufsTer23	frameshift_variant, stop_gained, missense_variant	Exon 13 of 50			ENSP00000504612.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs796051873; hg19: chr9-107594021;