9-127454547-A-AGCGGAAACCCAGTGAGGAGGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001005373.4(LRSAM1):c.21_41dupGCGGAAACCCAGTGAGGAGGC(p.Ala14_Arg15insArgLysProSerGluGluAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000576 in 1,614,088 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_001005373.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
LRSAM1 | NM_001005373.4 | c.21_41dupGCGGAAACCCAGTGAGGAGGC | p.Ala14_Arg15insArgLysProSerGluGluAla | disruptive_inframe_insertion | Exon 3 of 26 | ENST00000300417.11 | NP_001005373.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000296 AC: 45AN: 152220Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000677 AC: 17AN: 251196Hom.: 0 AF XY: 0.0000295 AC XY: 4AN XY: 135802
GnomAD4 exome AF: 0.0000328 AC: 48AN: 1461868Hom.: 0 Cov.: 31 AF XY: 0.0000234 AC XY: 17AN XY: 727236
GnomAD4 genome AF: 0.000296 AC: 45AN: 152220Hom.: 0 Cov.: 32 AF XY: 0.000282 AC XY: 21AN XY: 74368
ClinVar
Submissions by phenotype
Inborn genetic diseases Uncertain:1
The c.21_41dup21 variant (also known as p.K16_R17insRKPSEEA), located in coding exon 1 of the LRSAM1 gene, results from an in-frame insertion of GCGGAAACCCAGTGAGGAGGC due to the duplication of nucleotides 21 through 41. This results in the insertion of 7 extra residues (RKPSEEA) between codon 16 and codon 17. This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the supporting evidence, this variant is unlikely to be causative of autosomal dominant Charcot-Marie-Tooth disease, type 2P (CMT2P); however, its contribution to the development of autosomal recessive Charcot-Marie-Tooth disease, type 2P (CMT2P) is uncertain. -
not provided Uncertain:1
In-frame duplication of seven amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -
Charcot-Marie-Tooth disease axonal type 2P Uncertain:1
This variant, c.21_41dup, results in the insertion of 7 amino acid(s) of the LRSAM1 protein (p.Pro10_Lys16dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs760944483, gnomAD 0.1%). This variant has not been reported in the literature in individuals affected with LRSAM1-related conditions. ClinVar contains an entry for this variant (Variation ID: 961151). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at