chr9-127454547-A-AGCGGAAACCCAGTGAGGAGGC

Variant names:

• chr9-127454547-A-AGCGGAAACCCAGTGAGGAGGC
• rs760944483
• NM_001005373.4:c.21_41dupGCGGAAACCCAGTGAGGAGGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001005373.4(LRSAM1):​c.21_41dupGCGGAAACCCAGTGAGGAGGC​(p.Ala14_Arg15insArgLysProSerGluGluAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000576 in 1,614,088 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.00030 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000033 (0 hom.)
• Consequence: LRSAM1 NM_001005373.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.83

Genes affected

LRSAM1 (HGNC:25135): (leucine rich repeat and sterile alpha motif containing 1) This gene encodes a ring finger protein involved in a variety of functions, including regulation of signaling pathways and cell adhesion, mediation of self-ubiquitylation, and involvement in cargo sorting during receptor endocytosis. Mutations in this gene have been associated with Charcot-Marie-Tooth disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jan 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001005373.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LRSAM1	NM_001005373.4	c.21_41dupGCGGAAACCCAGTGAGGAGGC	p.Ala14_Arg15insArgLysProSerGluGluAla	disruptive_inframe_insertion	Exon 3 of 26	ENST00000300417.11	NP_001005373.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LRSAM1	ENST00000300417.11	c.21_41dupGCGGAAACCCAGTGAGGAGGC	p.Ala14_Arg15insArgLysProSerGluGluAla	disruptive_inframe_insertion	Exon 3 of 26	1	NM_001005373.4	ENSP00000300417.6

Frequencies

GnomAD3 genomes AF: 0.000296 AC: 45 AN: 152220 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00101

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000196

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000677 AC: 17 AN: 251196 Hom.: 0 AF XY: 0.0000295 AC XY: 4 AN XY: 135802

Gnomad AFR exome AF: 0.000862

Gnomad AMR exome AF: 0.0000868

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000328 AC: 48 AN: 1461868 Hom.: 0 Cov.: 31 AF XY: 0.0000234 AC XY: 17 AN XY: 727236

Gnomad4 AFR exome AF: 0.00111

Gnomad4 AMR exome AF: 0.0000894

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.0000993

GnomAD4 genome AF: 0.000296 AC: 45 AN: 152220 Hom.: 0 Cov.: 32 AF XY: 0.000282 AC XY: 21 AN XY: 74368

Gnomad4 AFR AF: 0.00101

Gnomad4 AMR AF: 0.000196

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Dec 20, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.21_41dup21 variant (also known as p.K16_R17insRKPSEEA), located in coding exon 1 of the LRSAM1 gene, results from an in-frame insertion of GCGGAAACCCAGTGAGGAGGC due to the duplication of nucleotides 21 through 41. This results in the insertion of 7 extra residues (RKPSEEA) between codon 16 and codon 17. This amino acid region is not well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the supporting evidence, this variant is unlikely to be causative of autosomal dominant Charcot-Marie-Tooth disease, type 2P (CMT2P); however, its contribution to the development of autosomal recessive Charcot-Marie-Tooth disease, type 2P (CMT2P) is uncertain. -

not provided Uncertain:1

Mar 14, 2023

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame duplication of seven amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -

Charcot-Marie-Tooth disease axonal type 2P Uncertain:1

Apr 20, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.21_41dup, results in the insertion of 7 amino acid(s) of the LRSAM1 protein (p.Pro10_Lys16dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs760944483, gnomAD 0.1%). This variant has not been reported in the literature in individuals affected with LRSAM1-related conditions. ClinVar contains an entry for this variant (Variation ID: 961151). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs760944483; hg19: chr9-130216826;