9-135786170-CGCCCTGCCCT-CGCCCTGCCCTGCCCTGCCCTGCCCTGCCCT

Position:

• chr9-135786170-CGCCCTGCCCT-CGCCCTGCCCTGCCCTGCCCTGCCCTGCCCT

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1

The NM_020822.3(KCNT1):​c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 0)
  • Exomes 𝑓: 7.2e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNT1 NM_020822.3 splice_acceptor, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.600

Genes affected

KCNT1 (HGNC:18865): (potassium sodium-activated channel subfamily T member 1) Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

KCNT1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KCNT1	NM_020822.3	c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC		splice_acceptor_variant, intron_variant		ENST00000371757.7	NP_065873.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KCNT1	ENST00000371757.7	c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC		splice_acceptor_variant, intron_variant		1	NM_020822.3	ENSP00000360822.2

Frequencies

GnomAD3 genomes AF: 0.00000664 AC: 1 AN: 150528 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 7.15e-7 AC: 1 AN: 1397656 Hom.: 0 Cov.: 12 AF XY: 0.00000144 AC XY: 1 AN XY: 696472

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.36e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000664 AC: 1 AN: 150528 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 73462

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs757968008; hg19: chr9-138678016;