9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAG

Variant names:

• chr9-2039776-ACAGCAGCAGCAGCAGCAGCAG-A
• rs113070757
• NM_003070.5:c.687_707delGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP6 BS1 BS2

The NM_003070.5(SMARCA2):​c.687_707delGCAGCAGCAGCAGCAGCAGCA​(p.Gln230_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000193 in 150,532 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00019 (0 hom., cov: 26)
  • Exomes 𝑓: 0.00029 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: SMARCA2 NM_003070.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.94

Genes affected

SMARCA2 (HGNC:11098): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP6: Variant 9-2039776-ACAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr9-2039776-ACAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 587833.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=1, Likely_benign=3}.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.000193 (29/150532) while in subpopulation NFE AF= 0.000252 (17/67586). AF 95% confidence interval is 0.00016. There are 0 homozygotes in gnomad4. There are 17 alleles in male gnomad4 subpopulation. Median coverage is 26. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 29 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SMARCA2	NM_003070.5	c.687_707delGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	ENST00000349721.8	NP_003061.3
SMARCA2	NM_001289396.2	c.687_707delGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236del	disruptive_inframe_deletion	Exon 4 of 34		NP_001276325.1
SMARCA2	NM_139045.4	c.687_707delGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236del	disruptive_inframe_deletion	Exon 4 of 33		NP_620614.2
SMARCA2	NM_001289397.2	c.687_707delGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236del	disruptive_inframe_deletion	Exon 4 of 33		NP_001276326.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SMARCA2	ENST00000349721.8	c.687_707delGCAGCAGCAGCAGCAGCAGCA	p.Gln230_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	5	NM_003070.5	ENSP00000265773.5

Frequencies

GnomAD3 genomes AF: 0.000193 AC: 29 AN: 150432 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.000196

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000193

Gnomad MID AF: 0.00318

Gnomad NFE AF: 0.000252

Gnomad OTH AF: 0.000484

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000289 AC: 418 AN: 1445818 Hom.: 1 AF XY: 0.000266 AC XY: 191 AN XY: 718570

Gnomad4 AFR exome AF: 0.000183

Gnomad4 AMR exome AF: 0.000304

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000294

Gnomad4 FIN exome AF: 0.000213

Gnomad4 NFE exome AF: 0.000299

Gnomad4 OTH exome AF: 0.000402

GnomAD4 genome AF: 0.000193 AC: 29 AN: 150532 Hom.: 0 Cov.: 26 AF XY: 0.000231 AC XY: 17 AN XY: 73486

Gnomad4 AFR AF: 0.000196

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000193

Gnomad4 NFE AF: 0.000252

Gnomad4 OTH AF: 0.000478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:2

Feb 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

SMARCA2: BP3 -

Jun 12, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SMARCA2-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.687_707del, results in the deletion of 7 amino acid(s) of the SMARCA2 protein (p.Gln232_Gln238del), but otherwise preserves the integrity of the reading frame. -

Jun 01, 2022

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

See Variant Classification Assertion Criteria. -

Inborn genetic diseases Benign:1

Mar 29, 2019

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs113070757; hg19: chr9-2039776;