9-21974795-A-AGGCTCCATGCTGCTCCCCGCCGCC

Position:

• chr9-21974795-A-AGGCTCCATGCTGCTCCCCGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PM1 PM4 PP5_Very_Strong

The NM_000077.5(CDKN2A):​c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC​(p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000305 in 1,606,474 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000039 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000030 (0 hom.)
• Consequence: CDKN2A NM_000077.5 disruptive_inframe_insertion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:14 O:1
• Conservation: PhyloP100: 0.139

Genes affected

CDKN2A (HGNC:1787): (cyclin dependent kinase inhibitor 2A) This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]

ENSG00000264545 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PM1: In a repeat ANK 1 (size 29) in uniprot entity CDN2A_HUMAN there are 5 pathogenic changes around while only 0 benign (100%) in NM_000077.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000077.5.
• PP5: Variant 9-21974795-A-AGGCTCCATGCTGCTCCCCGCCGCC is Pathogenic according to our data. Variant chr9-21974795-A-AGGCTCCATGCTGCTCCCCGCCGCC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 135827.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CDKN2A	NM_000077.5	c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC	p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro	disruptive_inframe_insertion	1/3	ENST00000304494.10	NP_000068.1
CDKN2A	NM_058195.4	c.194-3611_194-3588dupGGCGGCGGGGAGCAGCATGGAGCC		intron_variant		ENST00000579755.2	NP_478102.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CDKN2A	ENST00000304494.10	c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC	p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro	disruptive_inframe_insertion	1/3	1	NM_000077.5	ENSP00000307101.5
CDKN2A	ENST00000579755.2	c.194-3611_194-3588dupGGCGGCGGGGAGCAGCATGGAGCC		intron_variant		1	NM_058195.4	ENSP00000462950.1

Frequencies

GnomAD3 genomes AF: 0.0000395 AC: 6 AN: 151976 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000589

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00000855 AC: 2 AN: 233942 Hom.: 0 AF XY: 0.00000775 AC XY: 1 AN XY: 129094

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000584

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000296 AC: 43 AN: 1454498 Hom.: 0 Cov.: 32 AF XY: 0.0000304 AC XY: 22 AN XY: 723914

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000672

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.0000348

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000324

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000395 AC: 6 AN: 151976 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74234

Gnomad4 AFR AF: 0.0000242

Gnomad4 AMR AF: 0.0000655

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000589

Gnomad4 OTH AF: 0.00

EpiCase AF: 0.0000545

EpiControl AF: 0.00

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:14 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:5

Likely pathogenic, criteria provided, single submitter	clinical testing	AiLife Diagnostics, AiLife Diagnostics	Aug 18, 2021	- -
Pathogenic, criteria provided, single submitter	clinical testing	Quest Diagnostics Nichols Institute San Juan Capistrano	Feb 19, 2022	The frequency of this variant in the general population, 0.000011 (3/265240 chromosomes, http://gnomad.broadinstitute.org), is consistent with pathogenicity. In the published literature, the variant has been shown to co-segregate in multiple melanoma families (PMIDs: 8595405 (1995), 9328469 (1997), 9416844 (1997), 16307646 (2005)). It has also been identified in individuals affected with pancreatic cancer (PMID: 25356972 (2015)), colorectal cancer (PMIDs: 27978560 (2016), 28135145 (2017)), endometrial cancer (PMID: 29263814 (2016)), and osteosarcoma (PMID: 29263814 (2016)). Functional studies, however, have not conclusively identified the disease mechanism and some studies show that this variant retains most CDK4 binding activity (PMIDs: 8668202 (1996), 9516223 (1998), 20340136 (2010), 15945100 (2005)), cell cycle control (PMIDs: 8668202 (1996), 20340136 (2010)), and subcellular localization (PMID: 20340136 (2010)). In addition, one study described the variant as functionally impaired after showing it to have weaker cell cycle inhibition (PMID: 15945100 (2005)). Based on the available information, this variant is classified as pathogenic. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Genetic Services Laboratory, University of Chicago	Sep 01, 2021	This in-frame duplication is predicted to result in the duplication of 8 amino acid residues, p.Ala4_Pro11dup. This sequence change has been reported in the literature in individuals with melanoma and has been reported to segregate with the disease in the multiple families with reduced penetrance (PMIDs: 9516223, 16307646, 25803691, 9416844, 16397522, 9328469). The c.9_32dup sequence change has been described in three heterozygous individuals in gnomAD which corresponds to the population frequency of 0.0011% (dbSNP rs587780668). Functional studies showed that this mutant protein had a normal binding activity similar to the wild-type and they attributed it to the 8 amino acid insertions being located outside of the ankyrin motifs that are thought to be involved in CDK4 binding (PMID: 9516223). This change has also been described as 24 bp duplication/insertion, 23ins24, 32ins24, 32_33ins9-32, and p.M1_S8dup in published literature. -
Pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Aug 04, 2023	In-frame insertion of 8 amino acids in a non-repeat region; Observed in individuals with a personal or family history of melanoma, pancreatic, and other cancers (Monzon et al., 1998; Pollock et al., 1998; Aitken et al., 1999; Bishop et al., 2002; Goldstein et al., 2004; Lang et al., 2005; Eliason et al., 2006; Niendorf et al., 2006; Wadt et al., 2015; Zhen et al., 2015; Panou et al., 2018); In silico analysis supports that this variant does not alter protein structure/function; Not observed at significant frequency in large population cohorts (gnomAD); Also known as 23ins24, 1_24dup, 24_47dup24, 32-33ins9-32, 32ins24, M1_S8dup; This variant is associated with the following publications: (PMID: 26207792, 16905682, 16169933, 8668202, 20876876, 10070944, 28135137, 12072543, 16397522, 9416844, 17047042, 9328469, 25780468, 19759551, 16307646, 9516223, 28135136, 11159196, 25803691, 8595405, 28492532, 27978560, 28971906, 15945100, 25356972, 20340136, 9603434, 7559077, 28986857, 30113886, 30117292, 15173226, 9529249, 9653180, 16173922) -
Likely pathogenic, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Sep 29, 2023	- -

Hereditary cancer-predisposing syndrome Pathogenic:3

Pathogenic, criteria provided, single submitter	clinical testing	Ambry Genetics	Sep 05, 2024	The c.9_32dup24 pathogenic mutation (also known as p.A4_P11dup), located in coding exon 1 of the CDKN2A gene, results from an in-frame 24 nucleotide duplication between nucleotide positions 9 and 32. This results in the duplication of 8 extra amino acid residues between codons 4 and 11. This alteration has been shown to segregate with disease in multiple familial melanoma kindreds from several countries (Walker GJ et al. Hum. Mol. Genet. 1995 Oct;4:1845-52; Harland M et al. Hum. Mol. Genet. 1997 Nov;6:2061-7; Flores JF et al. Oncogene. 1997 Dec;15:2999-3005; Lang J et al. Br. J. Dermatol. 2005 Dec;153:1121-5; Eliason MJ et al. J. Invest. Dermatol. 2006 Mar;126:660-6). It has also been detected in a familial pancreatic cancer kindred as well as in individuals diagnosed with osteosarcoma, endometrial cancer, or colorectal cancer (Zhen DB et al. Genet. Med. 2015 Jul;17:569-77; Chan SH et al. Genomic Med. 2016;1; Pearlman R et al. JAMA Oncol. 2017 Apr 1;3(4):464-471). Several groups have performed in vitro assays to test for CDK4 binding and they have shown little impact on binding to CDK4 (Parry D and Peters G. Mol. Cell. Biol. 1996 Jul;16:3844-52; Monzon J et al. N. Engl. J. Med. 1998 Mar;38:879-87; Becker TM et al. Int. J. Cancer. 2005 Nov;117:569-73; McKenzie HA et al. Hum. Mutat. 2010 Jun;31:692-701). However, Becker et al. found this variant affects p16INK4a protein levels, its ability to inhibit S-phase when expressed at physiologic levels, and causes reduced phosphorylation of pRb, a downstream target. Of note, this alteration is also designated as 24 bp duplication/insertion, 23ins24, 32ins24, 32_33ins9-32, and p.M1_S8dup in published literature. Based on the available evidence, this alteration is classified as a pathogenic mutation. -
Likely pathogenic, criteria provided, single submitter	curation	Sema4, Sema4	Sep 13, 2021	- -
Pathogenic, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Mar 15, 2023	The CDKN2A locus encodes two different gene products, p16INK4a and p14ARF (https://www.ncbi.nlm.nih.gov/books/NBK7030/). This variant causes an in-frame duplication of 8 amino acids in the N-terminus of the CDKN2A (p16INK4A) protein. This variant is also known as c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3], c.1_24dup, c.23ins24 p.Met1_Ser8dup, c.32_33ins9-32 and c.32ins24 in the literature. This variant has been reported in up to twenty individuals affected with melanoma (PMID: 8595405, 9328469, 9416844, 9516223, 16307646, 16397522, 16905682, 20340136, 25803691, 28830827) and has been shown to segregate with melanoma in multiple families, with incomplete penetrance observed in some families (PMID: 8595405, 9328469, 9416844, 16397522). This variant is rare in the general population and has been identified in 3/265240 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Functional studies have reported conflicting results regarding the variant impact on cell cycle regulation. One study has shown that the mutant protein exhibits a partial loss of cell cycle-inhibitory activity and induces weaker S-phase inhibition than the wild-type protein and that cells expressing this mutant protein retain colony formation ability (PMID: 15945100). In this study, the cell cycle-regulatory defect of the mutant protein was associated with decreased inhibition of pRb (retinoblastoma) protein phosphorylation. Another study has shown no deleterious effect on induction of S phase inhibition (PMID: 20340136). It has also been shown that the mutant protein retains the ability to bind to CDK4 and/or CDK6 in vitro (PMID: 8668202, 9516223, 15945100, 20340136). However, CDK4/CDK6 binding activity may not be the relevant molecular consequence of this variant, as the variant lies outside the ankyrin repeats that mediate CDK4/CDK6 binding (PMID: 8880901). Although the available functional studies have not produced consistent findings, clinical observations strongly indicate this variant is associated with disease. Therefore, this variant is classified as Pathogenic. -

Familial melanoma Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 27, 2024	This variant, c.9_32dup, results in the insertion of 8 amino acid(s) of the CDKN2A (p16INK4a) protein (p.Ala4_Pro11dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs587780668, gnomAD 0.006%). This variant has been observed in individual(s) with melanoma (PMID: 8595405, 9328469, 9416844, 9516223, 16307646, 16397522, 25803691). It has also been observed to segregate with disease in related individuals. This variant is also known as 32_33ins9-32, 32ins24, and 23ins24. ClinVar contains an entry for this variant (Variation ID: 135827). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies are conflicting or provide insufficient evidence to determine the effect of this variant on CDKN2A (p16INK4a) function (PMID: 8668202, 9516223, 15945100). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Sep 19, 2024	Variant summary: CDKN2A c.9_32dup24 (p.Ala4_Pro11dup) results in an in-frame insertion of an additional copy of a 24 nucleotide repeat sequence that is naturally present in two copies at the 5' end of the CDKN2A gene; and is predicted to result in an insertion of 8 amino acids into the N-terminal end of the p16 (INK4A) protein. The variant allele was found at a frequency of 8.5e-06 in 233942 control chromosomes. c.9_32dup24 has been reported in the literature in multiple individuals affected with melanoma, with evidence of co-segregation with disease in affected families, however with reduced penetrance (Eliason_2006, Morzon_1998, Flores_1997, Harland_1997, Walker_1995, Lang_2005). These data indicate that the variant is very likely to be associated with disease. One study providing experimental evidence for evaluation of an impact on protein function demonstrated diminished cell cycle-inhibitory activity which was associated with decreased inhibition of pRb phosphorylation, even though it effectively bound CDK4 (Becker_2005). However, two other studies found that the variant was fully active in mediating cell cycle arrest, showed wild-type subcellular localization and bound effectively to CDK4 and CDK6 (McKenzie_2010, Monzon_1998). The following publications have been ascertained in the context of this evaluation (PMID: 15945100, 16397522, 9416844, 9328469, 16307646, 20340136, 9516223, 25803691, 8595405). ClinVar contains an entry for this variant (Variation ID: 135827). Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Melanoma and neural system tumor syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Baylor Genetics

Mar 29, 2024

- -

CDKN2A-related disorder Pathogenic:1

Likely pathogenic, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Aug 27, 2024

The CDKN2A c.9_32dup24 variant is predicted to result in an in-frame duplication (p.Ala4_Pro11dup). This variant was reported in multiple families with melanoma (Lang et al. 2005. PubMed ID: 16307646; Flores et al. 1997. PubMed ID: 9416844; Jovanovic et al. 2009. PubMed ID: 19759551; Bishop et al. 2002. PubMed ID: 12072543; Goldstein et al. 2006. PubMed ID: 16905682). In vitro experimental studies suggest this variant impacts protein function (Monzon et al. 1998. PubMed ID: 9516223; Becker et al. 2005. PubMed ID: 15945100). This variant is reported in 0.0057% of alleles in individuals of Latino descent in gnomAD. This variant is reported as likely pathogenic and pathogenic in ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/variation/135827/). This variant is interpreted as likely pathogenic. -

Melanoma-pancreatic cancer syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Illumina Laboratory Services, Illumina

Oct 03, 2018

The CDKN2A c.9_32dup (p.Ala4_Pro11dup) variant has been reported in at least five studies and is found in eleven probands from eight families in a heterozygous state (Monzon et al. 1998; Goldstein et al. 2006; Eliason et al. 2006; Zhen et al. 2015; Wadt et al. 2015). Probands exhibited a range of phenotypes including melanoma and pancreatic cancer. Control data are unavailable for the p.Ala4_Pro11dup variant, which is reported at a frequency of 0.000011 in the Total population of the Genome Aggregation Database. Expression analysis in WMM1175 melanoma cells found weak S-phase inhibition, decreased inhibition of pRb phosphorylation, and is indicated to be associated with defective in controlling cell proliferation (Becker et al. 2005). Analysis using yeast two-hybrid assay found 80% binding activity compared to wildtype (Monzon et al. 1998). Based on the evidence, the c.9_32dup (p.Ala4_Pro11dup) variant is classified as pathogenic for melanoma-pancreatic cancer syndrome. -

Melanoma and neural system tumor syndrome;C1835044:Melanoma, cutaneous malignant, susceptibility to, 2;C1838547:Melanoma-pancreatic cancer syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Mar 26, 2022

- -

Melanoma, cutaneous malignant, susceptibility to, 2 Other:1

risk factor, no assertion criteria provided

literature only

OMIM

Jun 01, 2010

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587780668; hg19: chr9-21974794;