NM_000077.5:c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC

Variant names:

• chr9-21974795-A-AGGCTCCATGCTGCTCCCCGCCGCC
• rs587780668
• NM_000077.5:c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC

GermlineCancer (beta)

Variant summary

Our verdict is Pathogenic.

+12 Pathogenic

-7

-6

-1

0

+5

+6

+9

+10

BenignB

Likely BenignLB

UncertainVUS

Likely PathogenicLP

PathogenicP

The variant received 12 classification points (ACMG Germline Pathogenicity v2019): 12P and 0B. PS3PM1_SupportingPM2_SupportingPM4PP5_Strong

The NM_000077.5(CDKN2A):c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC (p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro) variant causes a disruptive inframe insertion change. The variant results in an in-frame change. Note: allele frequency estimates from gnomAD may be inaccurate for this variant type (MNP or indel longer than 3 bp) due to technology limitations. The variant allele was found at a cumulative frequency of 0.0000305 (AC=49) in the gnomAD database across 1,606,474 control chromosomes (no homozygotes observed). The grpmax filtering allele frequency (95% CI) is 0.0000237. Variant has been reported in ClinVar as Pathogenic/Likely Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV001362182: One study providing experimental evidence for evaluation of an impact on protein function demonstrated diminished cell cycle-inhibitory activity which was associated with decreased inhibition of pRb phosphorylation, even though it effectively bound CDK4 (Becker_2005)." and additional evidence is available in ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000039 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000030 (0 hom.)
• Consequence: CDKN2A NM_000077.5 disruptive_inframe_insertion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:18 O:1
• Conservation: PhyloP100: 0.139
• Publications: 5 publications found

Genes affected

CDKN2A (HGNC:1787): (cyclin dependent kinase inhibitor 2A) This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]

CDKN2A Gene-Disease associations (from GenCC):

• melanoma, cutaneous malignant, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• melanoma-pancreatic cancer syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• familial atypical multiple mole melanoma syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• melanoma and neural system tumor syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ENSG00000264545 (HGNC:):

Classification according to ACMG Germline Pathogenicity v2019

Our verdict: Pathogenic. The variant received 12 points.

• PS3: Well-established functional study supports damaging effect (PS3); SCV001362182: One study providing experimental evidence for evaluation of an impact on protein function demonstrated diminished cell cycle-inhibitory activity which was associated with decreased inhibition of pRb phosphorylation, even though it effectively bound CDK4 (Becker_2005).; SCV002072289: Functional studies showed that this mutant protein had a normal binding activity similar to the wild-type and they attributed it to the 8 amino acid insertions being located outside of the ankyrin motifs that are thought to be involved in CDK4 binding (PMID: 9516223).; SCV004221647: Functional studies, however, have not conclusively identified the disease mechanism and some studies show that this variant retains most CDK4 binding activity (PMIDs: 8668202 (1996), 9516223 (1998), 20340136 (2010), 15945100 (2005)), cell cycle control (PMIDs: 8668202 (1996), 20340136 (2010)), and subcellular localization (PMID: 20340136 (2010)). In addition, one study described the variant as functionally impaired after showing it to have weaker cell cycle inhibition (PMID: 15945100 (2005)).; SCV000214174: Becker et al. found this variant affects p16INK4a protein levels, its ability to inhibit S-phase when expressed at physiologic levels, and causes reduced phosphorylation of pRb, a downstream target. PMID:25044467; SCV000689617: Functional studies have reported conflicting results regarding the variant impact on cell cycle regulation. One study has shown that the mutant protein exhibits a partial loss of cell cycle-inhibitory activity and induces weaker S-phase inhibition than the wild-type protein and that cells expressing this mutant protein retain colony formation ability (PMID: 15945100). In this study, the cell cycle-regulatory defect of the mutant protein was associated with decreased inhibition of pRb (retinoblastoma) protein phosphorylation. Another study has shown no deleterious effect on induction of S phase inhibition (PMID: 20340136). It has also been shown that the mutant protein retains the ability to bind to CDK4 and/or CDK6 in vitro (PMID: 8668202, 9516223, 15945100, 20340136).; SCV004801527: Expression analysis in WMM1175 melanoma cells found weak S-phase inhibition, decreased inhibition of pRb phosphorylation, and is indicated to be associated with defective in controlling cell proliferation (Becker et al. 2005). Analysis using yeast two-hybrid assay found 80% binding activity compared to wildtype (Monzon et al. 1998).; SCV000805833: "In vitro experimental studies suggest this variant impacts protein function (Monzon et al. 1998. PubMed ID: 9516223; Becker et al. 2005. PubMed ID: 15945100)."
• PM1: Missense neighbourhood moderate hotspot (≥2 P/LP within ±8 AA, OR ≥ 2 vs. background) — PM1 supporting; In-domain: 0 pathogenic, 0 benign rare missense variants.; ±8 AA neighbourhood: 5 pathogenic, 13 benign (OR vs. background: 2.0).
• PM2: Rare in gnomAD for AD/XL gene (popmax AF below threshold) — PM2 Supporting; GnomAD popmax AF = 0.0000237 — borderline rare for AD/XL gene (base 0.0001, raised to 0.00011 by highest known P/LP ClinVar AF 0.00011) — PM2 supporting.
• PM4: In-frame indel in non-repetitive region — protein length change (PM4); In-frame indel in non-repetitive region — protein length change (8 AA).
• PP5: ClinVar 2-star pathogenic — strong (PP5); ClinVar submissions overwhelmingly pathogenic (≥10 total, ≥80% P/LP, <10% B/LB) — strong (PP5, count-based); ClinVar germline classification: Pathogenic/Likely Pathogenic, 2 star(s). ClinVar submissions strongly and reliably favor pathogenicity (18/18 total P/LP).

Variant Effect in Transcripts

Automated classification analysis was done for transcript: NM_000077.5. You can select a different transcript below to see updated classification assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDKN2A	NM_000077.5	MANE Select	c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC	p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro	disruptive_inframe_insertion	Exon 1 of 3	NP_000068.1	P42771-1
	CDKN2A	NM_058195.4	MANE Plus Clinical	c.194-3611_194-3588dupGGCGGCGGGGAGCAGCATGGAGCC		intron	N/A	NP_478102.2	Q8N726-1
	CDKN2A	NM_001195132.2		c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC	p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro	disruptive_inframe_insertion	Exon 1 of 4	NP_001182061.1	P42771-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDKN2A	ENST00000304494.10	TSL:1 MANE Select	c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC	p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro	disruptive_inframe_insertion	Exon 1 of 3	ENSP00000307101.5	P42771-1
	CDKN2A	ENST00000498124.1	TSL:1	c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC	p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro	disruptive_inframe_insertion	Exon 1 of 4	ENSP00000418915.1	P42771-4
	CDKN2A	ENST00000579755.2	TSL:1 MANE Plus Clinical	c.194-3611_194-3588dupGGCGGCGGGGAGCAGCATGGAGCC		intron	N/A	ENSP00000462950.1	Q8N726-1

Frequencies

GnomAD3 genomes AF: 0.0000395 AC: 6 AN: 151976 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000589

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000855 AC: 2 AN: 233942 AF XY: 0.00000775

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000584

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000296 AC: 43 AN: 1454498 Hom.: 0 Cov.: 32 AF XY: 0.0000304 AC XY: 22 AN XY: 723914

African (AFR) AF: 0.00 AC: 0 AN: 33442

American (AMR) AF: 0.0000672 AC: 3 AN: 44622

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26028

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39678

South Asian (SAS) AF: 0.0000348 AC: 3 AN: 86120

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 47540

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5708

European-Non Finnish (NFE) AF: 0.0000324 AC: 36 AN: 1111110

Other (OTH) AF: 0.00 AC: 0 AN: 60250

GnomAD4 genome AF: 0.0000395 AC: 6 AN: 151976 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74234

African (AFR) AF: 0.0000242 AC: 1 AN: 41378

American (AMR) AF: 0.0000655 AC: 1 AN: 15266

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5158

South Asian (SAS) AF: 0.00 AC: 0 AN: 4820

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000589 AC: 4 AN: 67950

Other (OTH) AF: 0.00 AC: 0 AN: 2094

EpiCase AF: 0.0000545

EpiControl AF: 0.00

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
5	-	-	not provided (5)
3	-	-	Hereditary cancer-predisposing syndrome (3)
3	-	-	Melanoma-pancreatic cancer syndrome (3)
2	-	-	Familial melanoma (2)
2	-	-	Melanoma and neural system tumor syndrome (2)
1	-	-	CDKN2A-related disorder (1)
1	-	-	Melanoma and neural system tumor syndrome;C1835044:Melanoma, cutaneous malignant, susceptibility to, 2;C1838547:Melanoma-pancreatic cancer syndrome (1)
1	-	-	Melanoma, cutaneous malignant, susceptibility to, 2 (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.14
Mutation Taster		=36/64	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs587780668;

hg19: chr9-21974794;

COSMIC: COSV58724370;

ACMG debug oncogenicity

ACGS debug oncogenicity

ACMG debug germline

Submit to ClinVar