9-95477679-CATGGTTAGACAGGCATAGGCGAGCTGCAAGCAGAACA-C
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000264.5(PTCH1):c.1348-14_1370delTGTTCTGCTTGCAGCTCGCCTATGCCTGTCTAACCAT(p.Leu450fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
PTCH1
NM_000264.5 frameshift, splice_acceptor, splice_region, intron
NM_000264.5 frameshift, splice_acceptor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.36
Genes affected
PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-95477679-CATGGTTAGACAGGCATAGGCGAGCTGCAAGCAGAACA-C is Pathogenic according to our data. Variant chr9-95477679-CATGGTTAGACAGGCATAGGCGAGCTGCAAGCAGAACA-C is described in ClinVar as [Pathogenic]. Clinvar id is 524578.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PTCH1 | NM_000264.5 | c.1348-14_1370delTGTTCTGCTTGCAGCTCGCCTATGCCTGTCTAACCAT | p.Leu450fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | 10/24 | ENST00000331920.11 | NP_000255.2 | |
PTCH1 | NM_001083603.3 | c.1345-14_1367delTGTTCTGCTTGCAGCTCGCCTATGCCTGTCTAACCAT | p.Leu449fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | 10/24 | ENST00000437951.6 | NP_001077072.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PTCH1 | ENST00000331920.11 | c.1348-14_1370delTGTTCTGCTTGCAGCTCGCCTATGCCTGTCTAACCAT | p.Leu450fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | 10/24 | 5 | NM_000264.5 | ENSP00000332353.6 | ||
PTCH1 | ENST00000437951.6 | c.1345-14_1367delTGTTCTGCTTGCAGCTCGCCTATGCCTGTCTAACCAT | p.Leu449fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | 10/24 | 5 | NM_001083603.3 | ENSP00000389744.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Gorlin syndrome Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Aug 24, 2017 | For these reasons, this variant has been classified as Pathogenic. This variant is not present in population databases (ExAC no frequency). This variant is a gross deletion of the genomic region encompassing part of exon 10 of the PTCH1 gene, including the intron 9-exon 10 boundary (c.1348-14-1370del). This likely creates a premature translational stop signal and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in PTCH1 are known to be pathogenic (PMID: 16301862, 16419085). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at