9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000264.5(PTCH1):​c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT​(p.Tyr93GlyfsTer35) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L90L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

PTCH1
NM_000264.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 8.61
Variant links:
Genes affected
PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A is Pathogenic according to our data. Variant chr9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A is described in ClinVar as [Pathogenic]. Clinvar id is 220567.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PTCH1NM_000264.5 linkc.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT p.Tyr93GlyfsTer35 frameshift_variant Exon 2 of 24 ENST00000331920.11 NP_000255.2 Q13635-1
PTCH1NM_001083603.3 linkc.267_301delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT p.Tyr92GlyfsTer35 frameshift_variant Exon 2 of 24 ENST00000437951.6 NP_001077072.1 Q13635-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PTCH1ENST00000331920.11 linkc.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT p.Tyr93GlyfsTer35 frameshift_variant Exon 2 of 24 5 NM_000264.5 ENSP00000332353.6 Q13635-1
PTCH1ENST00000437951.6 linkc.267_301delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT p.Tyr92GlyfsTer35 frameshift_variant Exon 2 of 24 5 NM_001083603.3 ENSP00000389744.2 Q13635-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Gorlin syndrome Pathogenic:1
Jun 27, 2016
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in PTCH1 are known to be pathogenic (PMID: 16301862, 16419085). This sequence change deletes 35 nucleotides from exon 2 of the PTCH1 mRNA (c.270_304del), causing a frameshift at codon 93. This creates a premature translational stop signal (p.Tyr93Glyfs*35) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs864622583; hg19: chr9-98268778; API