chr9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A

Variant names:

• chr9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A
• rs864622583
• NM_000264.5:c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000264.5(PTCH1):​c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT​(p.Tyr93GlyfsTer35) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L90L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PTCH1 NM_000264.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.61
• Publications: 2 publications found

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

PTCH1 Gene-Disease associations (from GenCC):

• basal cell nevus syndrome 1

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• holoprosencephaly 7

  Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• nevoid basal cell carcinoma syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• holoprosencephaly

  Inheritance: AD Classification: LIMITED Submitted by: Illumina

ENSG00000271155 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A is Pathogenic according to our data. Variant chr9-95506496-AAGAACTTGCCGCAGTTTTTTTGAATGTAACAACCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 220567.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PTCH1	NM_000264.5	c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT	p.Tyr93GlyfsTer35	frameshift_variant	Exon 2 of 24	ENST00000331920.11	NP_000255.2
PTCH1	NM_001083603.3	c.267_301delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT	p.Tyr92GlyfsTer35	frameshift_variant	Exon 2 of 24	ENST00000437951.6	NP_001077072.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PTCH1	ENST00000331920.11	c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT	p.Tyr93GlyfsTer35	frameshift_variant	Exon 2 of 24	5	NM_000264.5	ENSP00000332353.6
PTCH1	ENST00000437951.6	c.267_301delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT	p.Tyr92GlyfsTer35	frameshift_variant	Exon 2 of 24	5	NM_001083603.3	ENSP00000389744.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Gorlin syndrome Pathogenic:1

Jun 27, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in PTCH1 are known to be pathogenic (PMID: 16301862, 16419085). This sequence change deletes 35 nucleotides from exon 2 of the PTCH1 mRNA (c.270_304del), causing a frameshift at codon 93. This creates a premature translational stop signal (p.Tyr93Glyfs*35) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.6
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs864622583; hg19: chr9-98268778;