rs864622583
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000264.5(PTCH1):c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT(p.Tyr93GlyfsTer35) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000264.5 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PTCH1 | NM_000264.5 | c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT | p.Tyr93GlyfsTer35 | frameshift_variant | Exon 2 of 24 | ENST00000331920.11 | NP_000255.2 | |
PTCH1 | NM_001083603.3 | c.267_301delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT | p.Tyr92GlyfsTer35 | frameshift_variant | Exon 2 of 24 | ENST00000437951.6 | NP_001077072.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PTCH1 | ENST00000331920.11 | c.270_304delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT | p.Tyr93GlyfsTer35 | frameshift_variant | Exon 2 of 24 | 5 | NM_000264.5 | ENSP00000332353.6 | ||
PTCH1 | ENST00000437951.6 | c.267_301delGGGTTGTTACATTCAAAAAAACTGCGGCAAGTTCT | p.Tyr92GlyfsTer35 | frameshift_variant | Exon 2 of 24 | 5 | NM_001083603.3 | ENSP00000389744.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Gorlin syndrome Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in PTCH1 are known to be pathogenic (PMID: 16301862, 16419085). This sequence change deletes 35 nucleotides from exon 2 of the PTCH1 mRNA (c.270_304del), causing a frameshift at codon 93. This creates a premature translational stop signal (p.Tyr93Glyfs*35) and is expected to result in an absent or disrupted protein product. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at