9-97675480-A-AAGTCTTACGGTACATGTCATCTTCTAGG

Variant names:

• chr9-97675480-A-AAGTCTTACGGTACATGTCATCTTCTAGG
• rs1564036110
• NM_000380.4:c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000380.4(XPA):​c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT​(p.Cys261ProfsTer4) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000089 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: XPA NM_000380.4 frameshift, stop_gained
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.672
• Publications: 0 publications found

Genes affected

XPA (HGNC:12814): (XPA, DNA damage recognition and repair factor) This gene encodes a zinc finger protein plays a central role in nucleotide excision repair (NER), a specialized type of DNA repair. NER is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens and chemotherapeutic drugs. The encoded protein interacts with DNA and several NER proteins, acting as a scaffold to assemble the NER incision complex at sites of DNA damage. Mutations in this gene cause Xeroderma pigmentosum complementation group A (XP-A), an autosomal recessive skin disorder featuring hypersensitivity to sunlight and increased risk for skin cancer. [provided by RefSeq, Aug 2017]

XPA Gene-Disease associations (from GenCC):

• xeroderma pigmentosum group A

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Myriad Women’s Health
• xeroderma pigmentosum

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0511 CDS is truncated, and there are 0 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
XPA	NM_000380.4	c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT	p.Cys261ProfsTer4	frameshift_variant, stop_gained	Exon 6 of 6	ENST00000375128.5	NP_000371.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
XPA	ENST00000375128.5	c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT	p.Cys261ProfsTer4	frameshift_variant, stop_gained	Exon 6 of 6	1	NM_000380.4	ENSP00000364270.5
XPA	ENST00000462523.5	n.*189_*216dupCCTAGAAGATGACATGTACCGTAAGACT		non_coding_transcript_exon_variant	Exon 7 of 7	5		ENSP00000433006.1
XPA	ENST00000485042.1	n.265_292dupCCTAGAAGATGACATGTACCGTAAGACT		non_coding_transcript_exon_variant	Exon 2 of 2	3
XPA	ENST00000462523.5	n.*189_*216dupCCTAGAAGATGACATGTACCGTAAGACT		3_prime_UTR_variant	Exon 7 of 7	5		ENSP00000433006.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000796 AC: 2 AN: 251194 AF XY: 0.0000147

Gnomad AFR exome AF: 0.000123

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000889 AC: 13 AN: 1461568 Hom.: 0 Cov.: 31 AF XY: 0.00000550 AC XY: 4 AN XY: 727070

African (AFR) AF: 0.0000597 AC: 2 AN: 33474

American (AMR) AF: 0.00 AC: 0 AN: 44702

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39682

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53410

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000989 AC: 11 AN: 1111766

Other (OTH) AF: 0.00 AC: 0 AN: 60380

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Sep 13, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Cys261Profs*4) in the XPA gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 13 amino acid(s) of the XPA protein. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with XPA-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.67

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1564036110; hg19: chr9-100437762;