rs1564036110
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2
The NM_000380.4(XPA):c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT(p.Cys261ProfsTer4) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000380.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
XPA | ENST00000375128.5 | c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT | p.Cys261ProfsTer4 | frameshift_variant, stop_gained | Exon 6 of 6 | 1 | NM_000380.4 | ENSP00000364270.5 | ||
XPA | ENST00000462523.5 | n.*189_*216dupCCTAGAAGATGACATGTACCGTAAGACT | non_coding_transcript_exon_variant | Exon 7 of 7 | 5 | ENSP00000433006.1 | ||||
XPA | ENST00000485042.1 | n.265_292dupCCTAGAAGATGACATGTACCGTAAGACT | non_coding_transcript_exon_variant | Exon 2 of 2 | 3 | |||||
XPA | ENST00000462523.5 | n.*189_*216dupCCTAGAAGATGACATGTACCGTAAGACT | 3_prime_UTR_variant | Exon 7 of 7 | 5 | ENSP00000433006.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.00000796 AC: 2AN: 251194Hom.: 0 AF XY: 0.0000147 AC XY: 2AN XY: 135762
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000889 AC: 13AN: 1461568Hom.: 0 Cov.: 31 AF XY: 0.00000550 AC XY: 4AN XY: 727070
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
This sequence change creates a premature translational stop signal (p.Cys261Profs*4) in the XPA gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 13 amino acid(s) of the XPA protein. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with XPA-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at