NM_000380.4:c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate
The NM_000380.4(XPA):c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT(p.Cys261ProfsTer4) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000380.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- xeroderma pigmentosum group AInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Myriad Women’s Health
- xeroderma pigmentosumInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
XPA | ENST00000375128.5 | c.753_780dupCCTAGAAGATGACATGTACCGTAAGACT | p.Cys261ProfsTer4 | frameshift_variant, stop_gained | Exon 6 of 6 | 1 | NM_000380.4 | ENSP00000364270.5 | ||
XPA | ENST00000462523.5 | n.*189_*216dupCCTAGAAGATGACATGTACCGTAAGACT | non_coding_transcript_exon_variant | Exon 7 of 7 | 5 | ENSP00000433006.1 | ||||
XPA | ENST00000485042.1 | n.265_292dupCCTAGAAGATGACATGTACCGTAAGACT | non_coding_transcript_exon_variant | Exon 2 of 2 | 3 | |||||
XPA | ENST00000462523.5 | n.*189_*216dupCCTAGAAGATGACATGTACCGTAAGACT | 3_prime_UTR_variant | Exon 7 of 7 | 5 | ENSP00000433006.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000796 AC: 2AN: 251194 AF XY: 0.0000147 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000889 AC: 13AN: 1461568Hom.: 0 Cov.: 31 AF XY: 0.00000550 AC XY: 4AN XY: 727070 show subpopulations
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
This sequence change creates a premature translational stop signal (p.Cys261Profs*4) in the XPA gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 13 amino acid(s) of the XPA protein. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with XPA-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at