9-98290631-G-GGCGGGGGCTGGCGGTGGGGCTGAC

Variant names:

• chr9-98290631-G-GGCGGGGGCTGGCGGTGGGGCTGAC
• NM_005458.8:c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_005458.8(GABBR2):​c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC​(p.Arg926_His927insValSerProThrAlaSerProArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: GABBR2 NM_005458.8 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.39

Genes affected

GABBR2 (HGNC:4507): (gamma-aminobutyric acid type B receptor subunit 2) The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_005458.8.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GABBR2	NM_005458.8	c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg926_His927insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 19 of 19	ENST00000259455.4	NP_005449.5
GABBR2	XM_017015331.3	c.2461_2484dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg828_His829insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 18 of 18		XP_016870820.1
GABBR2	XM_005252316.6	c.1981_2004dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg668_His669insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 17 of 17		XP_005252373.1
GABBR2	XM_017015332.3	c.1981_2004dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg668_His669insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 16 of 16		XP_016870821.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GABBR2	ENST00000259455.4	c.2755_2778dupGTCAGCCCCACCGCCAGCCCCCGC	p.Arg926_His927insValSerProThrAlaSerProArg	conservative_inframe_insertion	Exon 19 of 19	1	NM_005458.8	ENSP00000259455.2
GABBR2	ENST00000637410.1	n.2533_*15dupGTCAGCCCCACCGCCAGCCCCCGC		downstream_gene_variant		5

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Epileptic encephalopathy Uncertain:1

Jan 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.2755_2778dup, results in the insertion of 8 amino acid(s) of the GABBR2 protein (p.Val919_Arg926dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with GABBR2-related conditions. ClinVar contains an entry for this variant (Variation ID: 1427254). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-101052913;