ENST00000332972.9:c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The ENST00000332972.9(ADSS1):​c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 22)

Consequence

ADSS1
ENST00000332972.9 frameshift, start_lost

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.85
Variant links:
Genes affected
ADSS1 (HGNC:20093): (adenylosuccinate synthase 1) This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ADSS1NM_152328.5 linkc.193-5151_193-5126delCGTGGGGAGGAGCGTGGCGTCGGCAT intron_variant Intron 1 of 12 ENST00000330877.7 NP_689541.1 Q8N142-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ADSS1ENST00000330877.7 linkc.193-5151_193-5126delCGTGGGGAGGAGCGTGGCGTCGGCAT intron_variant Intron 1 of 12 1 NM_152328.5 ENSP00000331260.2 Q8N142-1

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Feb 21, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with ADSSL1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the ADSSL1 mRNA. The next in-frame methionine is located at codon 249. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr14-105196204; API