chr14-104729867-GTCGTGGGGAGGAGCGTGGCGTCGGCA-G
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_199165.2(ADSS1):c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_199165.2 frameshift, start_lost
Scores
Clinical Significance
Conservation
Publications
- myopathy, distal, 5Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_199165.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ADSS1 | MANE Select | c.193-5151_193-5126delCGTGGGGAGGAGCGTGGCGTCGGCAT | intron | N/A | NP_689541.1 | Q8N142-1 | |||
| ADSS1 | c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT | p.Met1fs | frameshift start_lost | Exon 1 of 13 | NP_954634.1 | B3KTV4 | |||
| ADSS1 | c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT | 5_prime_UTR | Exon 1 of 13 | NP_954634.1 | B3KTV4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ADSS1 | TSL:1 | c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT | p.Met1fs | frameshift start_lost | Exon 1 of 13 | ENSP00000333019.5 | Q8N142-2 | ||
| ADSS1 | TSL:1 | c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT | 5_prime_UTR | Exon 1 of 13 | ENSP00000333019.5 | Q8N142-2 | |||
| ADSS1 | TSL:1 MANE Select | c.193-5151_193-5126delCGTGGGGAGGAGCGTGGCGTCGGCAT | intron | N/A | ENSP00000331260.2 | Q8N142-1 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at