chr14-104729867-GTCGTGGGGAGGAGCGTGGCGTCGGCA-G

Variant names:

• chr14-104729867-GTCGTGGGGAGGAGCGTGGCGTCGGCA-G
• rs2140752520
• ENST00000332972.9:c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_199165.2(ADSS1):​c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: ADSS1 NM_199165.2 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.85
• Publications: 0 publications found

Genes affected

ADSS1 (HGNC:20093): (adenylosuccinate synthase 1) This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

ADSS1 Gene-Disease associations (from GenCC):

• myopathy, distal, 5

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 22 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_199165.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADSS1	NM_152328.5	MANE Select	c.193-5151_193-5126delCGTGGGGAGGAGCGTGGCGTCGGCAT		intron	N/A	NP_689541.1	Q8N142-1
	ADSS1	NM_199165.2		c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT	p.Met1fs	frameshift start_lost	Exon 1 of 13	NP_954634.1	B3KTV4
	ADSS1	NM_199165.2		c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT		5_prime_UTR	Exon 1 of 13	NP_954634.1	B3KTV4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADSS1	ENST00000332972.9	TSL:1	c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT	p.Met1fs	frameshift start_lost	Exon 1 of 13	ENSP00000333019.5	Q8N142-2
	ADSS1	ENST00000332972.9	TSL:1	c.-24_2delCGTGGGGAGGAGCGTGGCGTCGGCAT		5_prime_UTR	Exon 1 of 13	ENSP00000333019.5	Q8N142-2
	ADSS1	ENST00000330877.7	TSL:1 MANE Select	c.193-5151_193-5126delCGTGGGGAGGAGCGTGGCGTCGGCAT		intron	N/A	ENSP00000331260.2	Q8N142-1

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2140752520; hg19: chr14-105196204;