ENST00000360864.9:c.-12_-12+27delGGTGAGCTCGCTGCGGGTCGGGCGGGCG
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 4P and 4B. PVS1_StrongBS2
The ENST00000360864(DNAJC5):c.-12_-12+27delGGTGAGCTCGCTGCGGGTCGGGCGGGCG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000104 in 144,326 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
ENST00000360864 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
DNAJC5 | NM_025219.3 | c.-12+1_-12+28delGTGAGCTCGCTGCGGGTCGGGCGGGCGG | splice_donor_variant, splice_region_variant, intron_variant | Intron 1 of 4 | ENST00000360864.9 | NP_079495.1 | ||
DNAJC5 | XM_047440509.1 | c.-1696_-1669delGTGAGCTCGCTGCGGGTCGGGCGGGCGG | 5_prime_UTR_variant | Exon 1 of 5 | XP_047296465.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
DNAJC5 | ENST00000360864.9 | c.-12_-12+27delGGTGAGCTCGCTGCGGGTCGGGCGGGCG | splice_region_variant | Exon 1 of 5 | 1 | NM_025219.3 | ENSP00000354111.4 | |||
DNAJC5 | ENST00000360864 | c.-12_-12+27delGGTGAGCTCGCTGCGGGTCGGGCGGGCG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 5 | 1 | NM_025219.3 | ENSP00000354111.4 | |||
DNAJC5 | ENST00000360864.9 | c.-12_-12+27delGGTGAGCTCGCTGCGGGTCGGGCGGGCG | non_coding_transcript_variant | 1 | NM_025219.3 | ENSP00000354111.4 |
Frequencies
GnomAD3 genomes AF: 0.000104 AC: 15AN: 144326Hom.: 0 Cov.: 32
GnomAD4 genome AF: 0.000104 AC: 15AN: 144326Hom.: 0 Cov.: 32 AF XY: 0.0000713 AC XY: 5AN XY: 70144
ClinVar
Submissions by phenotype
not provided Uncertain:1
In silico analysis supports a deleterious effect on splicing; Has not been previously published as pathogenic or benign to our knowledge; No data available from control populations to assess the frequency of this variant -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at