ENST00000419408.5:c.295-26363_295-26323delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC

Variant names:

• chr2-239921636-TGCATTTTACAAACCTCTTGCTACTACAGAGCACTGATTGGC-T
• rs547407637
• ENST00000419408.5:c.295-26363_295-26323delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The ENST00000419408.5(NDUFA10):​c.295-26363_295-26323delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0611 in 152,204 control chromosomes in the GnomAD database, including 362 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: 𝑓 0.061 (362 hom., cov: 31)
• Consequence: NDUFA10 ENST00000419408.5 intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 0.252
• Publications: 0 publications found

Genes affected

NDUFA10 (HGNC:7684): (NADH:ubiquinone oxidoreductase subunit A10) The protein encoded by this gene is a component of 42 kDa complex I, the first enzyme complex in the electron transport chain of mitochondria. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. A mutation in this gene was found in an individual with Leigh syndrome. [provided by RefSeq, Apr 2016]

NDUFA10 Gene-Disease associations (from GenCC):

• mitochondrial complex I deficiency, nuclear type 22

  Inheritance: AR Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• mitochondrial disease

  Inheritance: AR Classification: MODERATE Submitted by: ClinGen
• Leigh syndrome with leukodystrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Leigh syndrome

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.0975 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000419408.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NDUFA10	NR_136158.2		n.3974-8687_3974-8647delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NDUFA10	ENST00000419408.5	TSL:5	c.295-26363_295-26323delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC		intron	N/A	ENSP00000408055.1	H7C2W5
	NDUFA10	ENST00000677057.1		n.4029-8687_4029-8647delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC		intron	N/A
	NDUFA10	ENST00000679183.1		n.1000-8687_1000-8647delGCCAATCAGTGCTCTGTAGTAGCAAGAGGTTTGTAAAATGC		intron	N/A	ENSP00000503016.1	A0A7I2V2N6

Frequencies

GnomAD3 genomes AF: 0.0611 AC: 9290 AN: 152086 Hom.: 363 Cov.: 31

Gnomad AFR AF: 0.0240

Gnomad AMI AF: 0.0954

Gnomad AMR AF: 0.0472

Gnomad ASJ AF: 0.111

Gnomad EAS AF: 0.105

Gnomad SAS AF: 0.0802

Gnomad FIN AF: 0.0855

Gnomad MID AF: 0.0854

Gnomad NFE AF: 0.0750

Gnomad OTH AF: 0.0664

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0611 AC: 9296 AN: 152204 Hom.: 362 Cov.: 31 AF XY: 0.0612 AC XY: 4557 AN XY: 74424

African (AFR) AF: 0.0242 AC: 1004 AN: 41548

American (AMR) AF: 0.0471 AC: 721 AN: 15298

Ashkenazi Jewish (ASJ) AF: 0.111 AC: 384 AN: 3468

East Asian (EAS) AF: 0.105 AC: 541 AN: 5160

South Asian (SAS) AF: 0.0807 AC: 389 AN: 4820

European-Finnish (FIN) AF: 0.0855 AC: 907 AN: 10602

Middle Eastern (MID) AF: 0.0782 AC: 23 AN: 294

European-Non Finnish (NFE) AF: 0.0750 AC: 5100 AN: 67986

Other (OTH) AF: 0.0662 AC: 140 AN: 2116

Alfa AF: 0.0545 Hom.: 39

Asia WGS AF: 0.0850 AC: 296 AN: 3478

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Schizophrenia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.25

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs547407637; hg19: chr2-240861053;