ENST00000429896.6:c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3PP5_Moderate

The ENST00000429896.6(PTCH1):​c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC variant causes a splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

PTCH1
ENST00000429896.6 splice_region

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.29

Publications

0 publications found
Variant links:
Genes affected
PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]
PTCH1 Gene-Disease associations (from GenCC):
  • basal cell nevus syndrome 1
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • holoprosencephaly 7
    Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
  • nevoid basal cell carcinoma syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
  • holoprosencephaly
    Inheritance: AD Classification: LIMITED Submitted by: Illumina

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C is Pathogenic according to our data. Variant chr9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 524530.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PTCH1NM_000264.5 linkc.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC p.Gly68fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 24 ENST00000331920.11 NP_000255.2 Q13635-1
PTCH1NM_001083603.3 linkc.199-16_224delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC p.Gly67fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 24 ENST00000437951.6 NP_001077072.1 Q13635-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PTCH1ENST00000331920.11 linkc.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC p.Gly68fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 24 5 NM_000264.5 ENSP00000332353.6 Q13635-1
PTCH1ENST00000437951.6 linkc.199-16_224delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC p.Gly67fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 24 5 NM_001083603.3 ENSP00000389744.2 Q13635-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Gorlin syndrome Pathogenic:1
Oct 31, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant is an out-of-frame deletion of the genomic region encompassing part of exon 2 of the PTCH1 gene including the exon 2-intron 2 boundary (c.202-16_227del). This is expected to create a premature translational stop signal and result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with PTCH1-related disease. Loss-of-function variants in PTCH1 are known to be pathogenic (PMID: 16301862, 16419085). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554708795; hg19: chr9-98268855; API