rs1554708795

Variant names:

• chr9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C
• rs1554708795
• ENST00000429896.6:c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000264.5(PTCH1):​c.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC​(p.Gly68fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PTCH1 NM_000264.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.29

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

ENSG00000271155 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C is Pathogenic according to our data. Variant chr9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C is described in ClinVar as [Pathogenic]. Clinvar id is 524530.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PTCH1	NM_000264.5	c.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC	p.Gly68fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 2 of 24	ENST00000331920.11	NP_000255.2
PTCH1	NM_001083603.3	c.199-16_224delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC	p.Gly67fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 2 of 24	ENST00000437951.6	NP_001077072.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PTCH1	ENST00000331920.11	c.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC	p.Gly68fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 2 of 24	5	NM_000264.5	ENSP00000332353.6
PTCH1	ENST00000437951.6	c.199-16_224delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC	p.Gly67fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 2 of 24	5	NM_001083603.3	ENSP00000389744.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Gorlin syndrome Pathogenic:1

Oct 31, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant is an out-of-frame deletion of the genomic region encompassing part of exon 2 of the PTCH1 gene including the exon 2-intron 2 boundary (c.202-16_227del). This is expected to create a premature translational stop signal and result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with PTCH1-related disease. Loss-of-function variants in PTCH1 are known to be pathogenic (PMID: 16301862, 16419085). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554708795; hg19: chr9-98268855;