rs1554708795

Variant names:

• chr9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C
• rs1554708795
• ENST00000429896.6:c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000264.5(PTCH1):​c.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC​(p.Gly68fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. G68G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PTCH1 NM_000264.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.29
• Publications: 0 publications found

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

PTCH1 Gene-Disease associations (from GenCC):

• basal cell nevus syndrome 1

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• holoprosencephaly 7

  Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• nevoid basal cell carcinoma syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• holoprosencephaly

  Inheritance: AD Classification: LIMITED Submitted by: Illumina

ENSG00000271155 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C is Pathogenic according to our data. Variant chr9-95506573-CGGCGCTTTCCGGCCAGTAGCCTTCCCCTGGGGACGAAGCAGA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 524530.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000264.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTCH1	NM_000264.5	MANE Select	c.202-16_227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC	p.Gly68fs	frameshift splice_acceptor splice_region intron	Exon 2 of 24	NP_000255.2
	PTCH1	NM_001083603.3	MANE Plus Clinical	c.199-16_224delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC	p.Gly67fs	frameshift splice_acceptor splice_region intron	Exon 2 of 24	NP_001077072.1
	PTCH1	NM_001083604.3		c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC		splice_region	Exon 2 of 24	NP_001077073.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTCH1	ENST00000429896.6	TSL:1	c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC		splice_region	Exon 2 of 24	ENSP00000414823.2
	PTCH1	ENST00000546820.5	TSL:1	c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC		splice_region	Exon 2 of 7	ENSP00000448843.1
	PTCH1	ENST00000547672.5	TSL:1	c.-252-16_-227delTCTGCTTCGTCCCCAGGGGAAGGCTACTGGCCGGAAAGCGCC		splice_region	Exon 2 of 7	ENSP00000447878.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Gorlin syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554708795; hg19: chr9-98268855;