ENST00000448810.6:n.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC

Variant names:

• chr5-132369709-CGCCTTCGCCGGCGCCGCTCTGCCTGCCA-C
• NM_003060.4:c.-261_-234delCTTCGCCGGCGCCGCTCTGCCTGCCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000448810.6(SLC22A5):​n.-263_-236delGCCTTCGCCGGCGCCGCTCTGCCTGCCA variant causes a upstream gene change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 33)
• Consequence: SLC22A5 ENST00000448810.6 upstream_gene
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.626
• Publications: 0 publications found

Genes affected

SLC22A5 (HGNC:10969): (solute carrier family 22 member 5) Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]

MIR3936HG (HGNC:40538): (MIR3936 host gene)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC22A5	NM_003060.4	c.-261_-234delCTTCGCCGGCGCCGCTCTGCCTGCCAGC		5_prime_UTR_variant	Exon 1 of 10	ENST00000245407.8	NP_003051.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC22A5	ENST00000245407.8	c.-261_-234delCTTCGCCGGCGCCGCTCTGCCTGCCAGC		5_prime_UTR_variant	Exon 1 of 10	1	NM_003060.4	ENSP00000245407.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.63

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr5-131705401;