ENST00000530902.5:n.147_167delAGCAGCAGCAGCAGCAGCAGC
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The ENST00000530902.5(PPP2R2B):n.147_167delAGCAGCAGCAGCAGCAGCAGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000462 in 1,297,488 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000530902.5 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 12Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PPP2R2B | NM_181675.4 | c.-282_-262delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR_variant | Exon 1 of 10 | ENST00000394411.9 | NP_858061.3 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| PPP2R2B | ENST00000394411.9 | c.-282_-262delAGCAGCAGCAGCAGCAGCAGC | 5_prime_UTR_variant | Exon 1 of 10 | 2 | NM_181675.4 | ENSP00000377933.3 |
Frequencies
GnomAD3 genomes AF: 0.00000665 AC: 1AN: 150488Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.00000436 AC: 5AN: 1147000Hom.: 0 AF XY: 0.00000712 AC XY: 4AN XY: 562108 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000665 AC: 1AN: 150488Hom.: 0 Cov.: 0 AF XY: 0.0000136 AC XY: 1AN XY: 73346 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at