ENST00000828660.1:n.-30_110del

Variant names:

• chr19-11089187-GGAGGATCTTTCAGAAGATGCGTTTCCAATTTTGAGGGGGCGTCAGCTCTTCACCGGAGACCCAAATACAACAAATCAAGTCGCCTGCCCTGGCGACACTTTCGAAGGACTGGAGTGGGAATCAGAGCTTCACGGGTTAAA-G
• ENST00000828660.1:n.-30_110del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000828660.1(ENSG00000307752):​n.-30_110del variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ENSG00000307752 ENST00000828660.1 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.878
• Publications: 0 publications found

Genes affected

ENSG00000307752 (HGNC:):

LDLR-AS1 (HGNC:54407): (LDLR antisense RNA 1) This gene represents a regulatory lncRNA that overlaps the 5' UTR and coding sequence of the LDLR (low density lipoprotein receptor) gene. This lncRNA overlaps LDLR in the antisense orientation, and has been shown to downregulate production of the low density lipoprotein receptor. [provided by RefSeq, Jul 2019]

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000828660.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR-AS1	NR_163945.1		n.333_472del		non_coding_transcript_exon	Exon 1 of 1
	LDLR	NM_000527.5	MANE Select	c.-361_-222del		upstream_gene	N/A	NP_000518.1
	LDLR	NM_001195798.2		c.-361_-222del		upstream_gene	N/A	NP_001182727.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENSG00000307752	ENST00000828660.1		n.-30_110del		non_coding_transcript_exon	Exon 1 of 1
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.-361_-222del		upstream_gene	N/A	ENSP00000454071.1
	LDLR	ENST00000558013.5	TSL:1	c.-361_-222del		upstream_gene	N/A	ENSP00000453346.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.88

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr19-11199863;