chr19-11089187-GGAGGATCTTTCAGAAGATGCGTTTCCAATTTTGAGGGGGCGTCAGCTCTTCACCGGAGACCCAAATACAACAAATCAAGTCGCCTGCCCTGGCGACACTTTCGAAGGACTGGAGTGGGAATCAGAGCTTCACGGGTTAAA-G
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NR_163945.1(LDLR-AS1):n.333_472del variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NR_163945.1 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- hypercholesterolemia, familial, 1Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
- homozygous familial hypercholesterolemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NR_163945.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDLR-AS1 | NR_163945.1 | n.333_472del | non_coding_transcript_exon | Exon 1 of 1 | |||||
| LDLR | NM_000527.5 | MANE Select | c.-361_-222del | upstream_gene | N/A | NP_000518.1 | |||
| LDLR | NM_001195798.2 | c.-361_-222del | upstream_gene | N/A | NP_001182727.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ENSG00000307752 | ENST00000828660.1 | n.-30_110del | non_coding_transcript_exon | Exon 1 of 1 | |||||
| LDLR | ENST00000558518.6 | TSL:1 MANE Select | c.-361_-222del | upstream_gene | N/A | ENSP00000454071.1 | |||
| LDLR | ENST00000558013.5 | TSL:1 | c.-361_-222del | upstream_gene | N/A | ENSP00000453346.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at