NM_000016.6:c.989_1010delTTGAACTAGCTAGAATGAGTTA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000016.6(ACADM):​c.989_1010delTTGAACTAGCTAGAATGAGTTA​(p.Val330AlafsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V330V) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

ACADM
NM_000016.6 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.21

Publications

0 publications found
Variant links:
Genes affected
ACADM (HGNC:89): (acyl-CoA dehydrogenase medium chain) This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
ACADM Gene-Disease associations (from GenCC):
  • medium chain acyl-CoA dehydrogenase deficiency
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, PanelApp Australia, ClinGen, Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 1-75761164-GTTGAACTAGCTAGAATGAGTTA-G is Pathogenic according to our data. Variant chr1-75761164-GTTGAACTAGCTAGAATGAGTTA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 458791.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ACADMNM_000016.6 linkc.989_1010delTTGAACTAGCTAGAATGAGTTA p.Val330AlafsTer32 frameshift_variant Exon 11 of 12 ENST00000370841.9 NP_000007.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ACADMENST00000370841.9 linkc.989_1010delTTGAACTAGCTAGAATGAGTTA p.Val330AlafsTer32 frameshift_variant Exon 11 of 12 1 NM_000016.6 ENSP00000359878.5

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Medium-chain acyl-coenzyme A dehydrogenase deficiency Pathogenic:1
Sep 24, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change deletes 22 nucleotides from exon 11 of the ACADM mRNA (c.989_1010delTTGAACTAGCTAGAATGAGTTA), causing a frameshift at codon 330. This creates a premature translational stop signal (p.Val330Alafs*32) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss of function variants in ACADM are known to be pathogenic (PMID: 8198141, 20434380). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.2
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553127172; hg19: chr1-76226849; API