rs1553127172

Positions:

• chr1-75761164-GTTGAACTAGCTAGAATGAGTTA-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000016.6(ACADM):​c.989_1010del​(p.Val330AlafsTer32) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACADM NM_000016.6 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.21

Genes affected

ACADM (HGNC:89): (acyl-CoA dehydrogenase medium chain) This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-75761164-GTTGAACTAGCTAGAATGAGTTA-G is Pathogenic according to our data. Variant chr1-75761164-GTTGAACTAGCTAGAATGAGTTA-G is described in ClinVar as [Pathogenic]. Clinvar id is 458791.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ACADM	NM_000016.6	c.989_1010del	p.Val330AlafsTer32	frameshift_variant	11/12	ENST00000370841.9	NP_000007.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ACADM	ENST00000370841.9	c.989_1010del	p.Val330AlafsTer32	frameshift_variant	11/12	1	NM_000016.6	ENSP00000359878	P4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Medium-chain acyl-coenzyme A dehydrogenase deficiency Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 24, 2017

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss of function variants in ACADM are known to be pathogenic (PMID: 8198141, 20434380). This sequence change deletes 22 nucleotides from exon 11 of the ACADM mRNA (c.989_1010delTTGAACTAGCTAGAATGAGTTA), causing a frameshift at codon 330. This creates a premature translational stop signal (p.Val330Alafs*32) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553127172; hg19: chr1-76226849;