NM_000044.6:c.201_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_000044.6(AR):c.201_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln68_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.
Frequency
Consequence
NM_000044.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6 | c.201_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln68_Gln80dup | disruptive_inframe_insertion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000240 AC: 16AN: 66636Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000694 AC: 65AN: 937273Hom.: 0 Cov.: 40 AF XY: 0.0000339 AC XY: 10AN XY: 295385 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000240 AC: 16AN: 66623Hom.: 0 Cov.: 0 AF XY: 0.000121 AC XY: 1AN XY: 8259 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Androgen resistance syndrome;C0268301:Partial androgen insensitivity syndrome;C0376358:Prostate cancer;C1839259:Kennedy disease;C2678098:Hypospadias 1, X-linked Uncertain:1
- -
Kennedy disease Uncertain:1
- -
AR-related disorder Uncertain:1
The AR c.201_239dup39 variant is predicted to result in an in-frame duplication (p.Gln68_Gln80dup). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at