NM_000044.6:c.207_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3BP6_ModerateBS2
The NM_000044.6(AR):c.207_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln70_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.
Frequency
Consequence
NM_000044.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -7 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6 | c.207_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln70_Gln80dup | disruptive_inframe_insertion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000420 AC: 28AN: 66634Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000179 AC: 168AN: 937189Hom.: 0 Cov.: 40 AF XY: 0.0000576 AC XY: 17AN XY: 295285 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000420 AC: 28AN: 66621Hom.: 0 Cov.: 0 AF XY: 0.000484 AC XY: 4AN XY: 8259 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:1
- -
AR-related disorder Benign:1
This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at