NM_000044.6:c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3BP6_Very_StrongBS2
The NM_000044.6(AR):c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln73_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q80Q) has been classified as Likely benign.
Frequency
Consequence
NM_000044.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- androgen insensitivity syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
 - Kennedy diseaseInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
 - partial androgen insensitivity syndromeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
 - complete androgen insensitivity syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
 
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -13 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt | 
|---|---|---|---|---|---|---|---|---|
| AR | NM_000044.6  | c.216_239dupGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln73_Gln80dup | disruptive_inframe_insertion | Exon 1 of 8 | ENST00000374690.9 | NP_000035.2 | 
Ensembl
Frequencies
GnomAD3 genomes   AF:  0.00347  AC: 231AN: 66631Hom.:  7  Cov.: 0 show subpopulations 
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF:  0.00132  AC: 1232AN: 936378Hom.:  0  Cov.: 40 AF XY:  0.000255  AC XY: 75AN XY: 294596 show subpopulations  ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5. 
Age Distribution
GnomAD4 genome   AF:  0.00345  AC: 230AN: 66618Hom.:  7  Cov.: 0 AF XY:  0.00157  AC XY: 13AN XY: 8258 show subpopulations 
Age Distribution
ClinVar
Submissions by phenotype
not specified    Benign:1 
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
Androgen resistance syndrome;C1839259:Kennedy disease    Benign:1 
- -
Computational scores
Source: 
Splicing
 Find out detailed SpliceAI scores and Pangolin per-transcript scores at