NM_000046.5:c.1534_1556delGTGTACTTCCCTGCACAGGACCC
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_000046.5(ARSB):c.1534_1556delGTGTACTTCCCTGCACAGGACCC(p.Val512ProfsTer3) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000031 in 1,614,008 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_000046.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- mucopolysaccharidosis type 6Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, Illumina, G2P
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000046.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ARSB | TSL:1 MANE Select | c.1534_1556delGTGTACTTCCCTGCACAGGACCC | p.Val512ProfsTer3 | frameshift | Exon 8 of 8 | ENSP00000264914.4 | P15848-1 | ||
| ARSB | c.1507_1529delGTGTACTTCCCTGCACAGGACCC | p.Val503ProfsTer3 | frameshift | Exon 8 of 8 | ENSP00000604397.1 | ||||
| ARSB | TSL:3 | n.499_521delGTGTACTTCCCTGCACAGGACCC | non_coding_transcript_exon | Exon 3 of 3 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152150Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251398 AF XY: 0.00000736 show subpopulations
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1461858Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 727234 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152150Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74332 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at