chr5-78780442-GGGGTCCTGTGCAGGGAAGTACAC-G

Variant names:

• chr5-78780442-GGGGTCCTGTGCAGGGAAGTACAC-G
• rs1310996698
• NM_000046.5:c.1534_1556delGTGTACTTCCCTGCACAGGACCC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_Strong PP5_Very_Strong

The NM_000046.5(ARSB):​c.1534_1556delGTGTACTTCCCTGCACAGGACCC​(p.Val512ProfsTer3) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000031 in 1,614,008 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: ARSB NM_000046.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4 U:1
• Conservation: PhyloP100: 6.75
• Publications: 1 publications found

Genes affected

ARSB (HGNC:714): (arylsulfatase B) Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]

ARSB Gene-Disease associations (from GenCC):

• mucopolysaccharidosis type 6

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen, Illumina, G2P

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
• PP5: Variant 5-78780442-GGGGTCCTGTGCAGGGAAGTACAC-G is Pathogenic according to our data. Variant chr5-78780442-GGGGTCCTGTGCAGGGAAGTACAC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 559721.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000046.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARSB	NM_000046.5	MANE Select	c.1534_1556delGTGTACTTCCCTGCACAGGACCC	p.Val512ProfsTer3	frameshift	Exon 8 of 8	NP_000037.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARSB	ENST00000264914.10	TSL:1 MANE Select	c.1534_1556delGTGTACTTCCCTGCACAGGACCC	p.Val512ProfsTer3	frameshift	Exon 8 of 8	ENSP00000264914.4	P15848-1
	ARSB	ENST00000934338.1		c.1507_1529delGTGTACTTCCCTGCACAGGACCC	p.Val503ProfsTer3	frameshift	Exon 8 of 8	ENSP00000604397.1
	ARSB	ENST00000521011.1	TSL:3	n.499_521delGTGTACTTCCCTGCACAGGACCC		non_coding_transcript_exon	Exon 3 of 3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152150 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251398 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1461858 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 727234

African (AFR) AF: 0.00 AC: 0 AN: 33474

American (AMR) AF: 0.0000224 AC: 1 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.00000180 AC: 2 AN: 1111994

Other (OTH) AF: 0.0000166 AC: 1 AN: 60392

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152150 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74332

African (AFR) AF: 0.00 AC: 0 AN: 41414

American (AMR) AF: 0.00 AC: 0 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5188

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
4	1	-	Mucopolysaccharidosis type 6 (5)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.8
Mutation Taster		=10/190	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1310996698; hg19: chr5-78076265;