chr5-78780442-GGGGTCCTGTGCAGGGAAGTACAC-G
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_000046.5(ARSB):c.1534_1556delGTGTACTTCCCTGCACAGGACCC(p.Val512ProfsTer3) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000031 in 1,614,008 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_000046.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- mucopolysaccharidosis type 6Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Genomics England PanelApp, Illumina, Labcorp Genetics (formerly Invitae), G2P, ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ARSB | NM_000046.5 | c.1534_1556delGTGTACTTCCCTGCACAGGACCC | p.Val512ProfsTer3 | frameshift_variant | Exon 8 of 8 | ENST00000264914.10 | NP_000037.2 | |
| ARSB | XM_011543390.2 | c.1534_1556delGTGTACTTCCCTGCACAGGACCC | p.Val512ProfsTer3 | frameshift_variant | Exon 9 of 9 | XP_011541692.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ARSB | ENST00000264914.10 | c.1534_1556delGTGTACTTCCCTGCACAGGACCC | p.Val512ProfsTer3 | frameshift_variant | Exon 8 of 8 | 1 | NM_000046.5 | ENSP00000264914.4 | ||
| ARSB | ENST00000521011.1 | n.499_521delGTGTACTTCCCTGCACAGGACCC | non_coding_transcript_exon_variant | Exon 3 of 3 | 3 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152150Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251398 AF XY: 0.00000736 show subpopulations
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1461858Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 727234 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152150Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74332 show subpopulations
ClinVar
Submissions by phenotype
Mucopolysaccharidosis type 6 Pathogenic:4Uncertain:1
- -
Absent from GnomAD (PM2 -
This sequence change creates a premature translational stop signal (p.Val512Profs*3) in the ARSB gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 22 amino acid(s) of the ARSB protein. This variant is present in population databases (no rsID available, gnomAD 0.0009%). This premature translational stop signal has been observed in individual(s) with mucopolysaccharidosis type VI (PMID: 17458871). ClinVar contains an entry for this variant (Variation ID: 559721). This variant disrupts a region of the ARSB protein in which other variant(s) (p.Thr526Metfs*48) have been determined to be pathogenic (PMID: 8116615, 24677745). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
- -
Variant summary: ARSB c.1534_1556del23 (p.Val512ProfsX3) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant allele was found at a frequency of 4e-06 in 251598 control chromosomes (gnomAD and publication data). c.1534_1556del23 has been reported in the literature in multiple individuals affected with Mucopolysaccharidosis Type VI (Maroteaux-Lamy Syndrome), including two homozygotes (Petry_2003, Petry_2005, Karageorgos_2007, Giraldo_2015). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. One ClinVar submitter (evaluation after 2014) cites the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at