NM_000048.4:c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC

Variant names:

• chr7-66089676-GCGTCATCTCTACGCTGCAGGCAAGA-G
• rs1329070853
• NM_000048.4:c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_000048.4(ASL):​c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC​(p.Val349_Gln354del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000124 in 1,613,486 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: ASL NM_000048.4 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 7.41

Genes affected

ASL (HGNC:746): (argininosuccinate lyase) This gene encodes a member of the lyase 1 family. The encoded protein forms a cytosolic homotetramer and primarily catalyzes the reversible hydrolytic cleavage of argininosuccinate into arginine and fumarate, an essential step in the liver in detoxifying ammonia via the urea cycle. Mutations in this gene result in the autosomal recessive disorder argininosuccinic aciduria, or argininosuccinic acid lyase deficiency. A nontranscribed pseudogene is also located on the long arm of chromosome 22. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ENSG00000249319 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.060215052 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.5, offset of -30, new splice context is: cagGTggcc. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-66089676-GCGTCATCTCTACGCTGCAGGCAAGA-G is Pathogenic according to our data. Variant chr7-66089676-GCGTCATCTCTACGCTGCAGGCAAGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 529426.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ASL	NM_000048.4	c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC	p.Val349_Gln354del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 14 of 17	ENST00000304874.14	NP_000039.2
ASL	NM_001024943.2	c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC	p.Val349_Gln354del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 13 of 16		NP_001020114.1
ASL	NM_001024944.2	c.985_1002+7delGTCATCTCTACGCTGCAGGCAAGAC	p.Val329_Gln334del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 15		NP_001020115.1
ASL	NM_001024946.2	c.967_984+7delGTCATCTCTACGCTGCAGGCAAGAC	p.Val323_Gln328del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 15		NP_001020117.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASL	ENST00000304874.14	c.1044_1062+6delCGTCATCTCTACGCTGCAGGCAAGA	p.Val349LysfsTer68	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 14 of 17	1	NM_000048.4	ENSP00000307188.9
ENSG00000249319	ENST00000450043.2	c.357_375+6delCGTCATCTCTACGCTGCAGGCAAGA	p.Val120LysfsTer78	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 5 of 12	5		ENSP00000396527.2

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152184 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461302 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726964

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152184 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74350

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Argininosuccinate lyase deficiency Pathogenic:2

Apr 27, 2023

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 22, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 14 (c.1045_1062+7del) of the ASL gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in ASL are known to be pathogenic (PMID: 2263616, 24166829). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with argininosuccinate lyase deficiency (PMID: 16941645; Invitae). ClinVar contains an entry for this variant (Variation ID: 529426). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1329070853; hg19: chr7-65554663;