rs1329070853
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_ModeratePP5_Very_Strong
The NM_000048.4(ASL):c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC(p.Val349_Gln354del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000124 in 1,613,486 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. V349V) has been classified as Likely benign.
Frequency
Consequence
NM_000048.4 splice_donor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- argininosuccinic aciduriaInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Myriad Women’s Health, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000048.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASL | MANE Select | c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC | p.Val349_Gln354del | splice_donor conservative_inframe_deletion splice_region intron | Exon 14 of 17 | NP_000039.2 | |||
| ASL | c.1045_1062+7delGTCATCTCTACGCTGCAGGCAAGAC | p.Val349_Gln354del | splice_donor conservative_inframe_deletion splice_region intron | Exon 13 of 16 | NP_001020114.1 | A0A024RDL8 | |||
| ASL | c.985_1002+7delGTCATCTCTACGCTGCAGGCAAGAC | p.Val329_Gln334del | splice_donor conservative_inframe_deletion splice_region intron | Exon 12 of 15 | NP_001020115.1 | P04424-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASL | TSL:1 MANE Select | c.1044_1062+6delCGTCATCTCTACGCTGCAGGCAAGA | p.Val349LysfsTer68 | frameshift splice_donor splice_region intron | Exon 14 of 17 | ENSP00000307188.9 | P04424-1 | ||
| ASL | TSL:1 | c.1044_1062+6delCGTCATCTCTACGCTGCAGGCAAGA | p.Val349LysfsTer68 | frameshift splice_donor splice_region intron | Exon 13 of 16 | ENSP00000378741.3 | P04424-1 | ||
| ENSG00000249319 | TSL:5 | c.357_375+6delCGTCATCTCTACGCTGCAGGCAAGA | p.Val120LysfsTer78 | frameshift splice_donor splice_region intron | Exon 5 of 12 | ENSP00000396527.2 | H7C0S8 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152184Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461302Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 726964 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152184Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74350 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at