NM_000051.4:c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG

Variant names:

• chr11-108333945-G-GTTGTCCCTACTATGGAAATTAAGGTAAT
• rs1555126295
• NM_000051.4:c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000051.4(ATM):​c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG variant causes a intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM NM_000051.4 intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 4.45
• Publications: 0 publications found

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000051.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATM	NM_000051.4	MANE Select	c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG		intron	N/A	NP_000042.3
	ATM	NM_001351834.2		c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG		intron	N/A	NP_001338763.1
	C11orf65	NM_001330368.2		c.641-24902_641-24875dupATTACCTTAATTTCCATAGTAGGGACAA		intron	N/A	NP_001317297.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATM	ENST00000675843.1	MANE Select	c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG		splice_acceptor intron	N/A	ENSP00000501606.1
	ATM	ENST00000452508.7	TSL:1	c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG		splice_acceptor intron	N/A	ENSP00000388058.2
	C11orf65	ENST00000615746.4	TSL:1	c.*1269+1274_*1269+1275insATTACCTTAATTTCCATAGTAGGGACAA		intron	N/A	ENSP00000483537.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Ataxia-telangiectasia syndrome Uncertain:2

Apr 11, 2025

Natera, Inc.

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

Dec 11, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with ATM-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This sequence change duplicates the last 20 nucleotides of exon 54 and the first 8 nucleotides of intron 54 (c.7991_8010+8dup). This results in the insertion of 28 nucleotides in intron 54, which is not expected to change the encoded amino acid sequence of the ATM protein. However, it generates a duplicated 5' consensus splice site in the intron. Algorithms developed to predict the effect of sequence changes on mRNA splicing suggest that this variant does not alter RNA splicing at the original consensus splice site. However, it may alter RNA splicing through the duplicated consensus splice site. This prediction has not been confirmed by published transcriptional studies.

Hereditary cancer-predisposing syndrome Uncertain:1

Apr 11, 2025

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.7991_8010+8DUP28 variant results from a duplication of 28 nucleotides between positions 7991 and 8010+8 and involves the canonical splice donor site after coding exon 53 of the ATM gene. The canonical splice donor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will result in the creation of a novel splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Based on the available evidence, the clinical significance of this variant remains unclear.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555126295; hg19: chr11-108204672;