rs1555126295
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The ENST00000675843.1(ATM):c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG variant causes a splice acceptor, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
ATM
ENST00000675843.1 splice_acceptor, intron
ENST00000675843.1 splice_acceptor, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 4.45
Genes affected
ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 10 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ATM | NM_000051.4 | c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG | intron_variant | ENST00000675843.1 | NP_000042.3 |
Ensembl
Frequencies
GnomAD3 genomes
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 30
GnomAD4 exome
Cov.:
30
GnomAD4 genome
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Ataxia-telangiectasia syndrome Uncertain:1
| Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Dec 11, 2017 | This sequence change duplicates the last 20 nucleotides of exon 54 and the first 8 nucleotides of intron 54 (c.7991_8010+8dup). This results in the insertion of 28 nucleotides in intron 54, which is not expected to change the encoded amino acid sequence of the ATM protein. However, it generates a duplicated 5' consensus splice site in the intron. Algorithms developed to predict the effect of sequence changes on mRNA splicing suggest that this variant does not alter RNA splicing at the original consensus splice site. However, it may alter RNA splicing through the duplicated consensus splice site. This prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant has not been reported in the literature in individuals with ATM-related disease. This variant is not present in population databases (ExAC no frequency). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at