rs1555126295

Variant names:

• chr11-108333945-G-GTTGTCCCTACTATGGAAATTAAGGTAAT
• rs1555126295
• NM_000051.4:c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The ENST00000675843.1(ATM):​c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG variant causes a splice acceptor, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM ENST00000675843.1 splice_acceptor, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.45

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATM	NM_000051.4	c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG		intron_variant	Intron 54 of 62	ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG		splice_acceptor_variant, intron_variant	Intron 53 of 62		NM_000051.4	ENSP00000501606.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Ataxia-telangiectasia syndrome Uncertain:1

Dec 11, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with ATM-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This sequence change duplicates the last 20 nucleotides of exon 54 and the first 8 nucleotides of intron 54 (c.7991_8010+8dup). This results in the insertion of 28 nucleotides in intron 54, which is not expected to change the encoded amino acid sequence of the ATM protein. However, it generates a duplicated 5' consensus splice site in the intron. Algorithms developed to predict the effect of sequence changes on mRNA splicing suggest that this variant does not alter RNA splicing at the original consensus splice site. However, it may alter RNA splicing through the duplicated consensus splice site. This prediction has not been confirmed by published transcriptional studies. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555126295; hg19: chr11-108204672;