rs1555126295

Variant names:

• chr11-108333945-G-GTTGTCCCTACTATGGAAATTAAGGTAAT
• rs1555126295
• NM_000051.4:c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The ENST00000675843.1(ATM):​c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG variant causes a splice acceptor, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). The gene ATM is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM ENST00000675843.1 splice_acceptor, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 4.45
• Publications: 0 publications found

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Specifications for ATM are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000675843.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATM	NM_000051.4	MANE Select	c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG		intron	N/A	NP_000042.3
	ATM	NM_001351834.2		c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG		intron	N/A	NP_001338763.1	Q13315
	C11orf65	NM_001330368.2		c.641-24902_641-24875dupATTACCTTAATTTCCATAGTAGGGACAA		intron	N/A	NP_001317297.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATM	ENST00000675843.1	MANE Select	c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG		splice_acceptor intron	N/A	ENSP00000501606.1	Q13315
	ATM	ENST00000452508.7	TSL:1	c.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG		splice_acceptor intron	N/A	ENSP00000388058.2	Q13315
	C11orf65	ENST00000615746.4	TSL:1	c.*1269+1274_*1269+1275insATTACCTTAATTTCCATAGTAGGGACAA		intron	N/A	ENSP00000483537.1	Q8NCR3-1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	Ataxia-telangiectasia syndrome (2)
-	1	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555126295; hg19: chr11-108204672;