rs1555126295

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000051.4(ATM):​c.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG variant causes a intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

ATM
NM_000051.4 intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:3

Conservation

PhyloP100: 4.45

Publications

0 publications found
Variant links:
Genes affected
ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ATMNM_000051.4 linkc.7991_8010+8dupTCCCTACTATGGAAATTAAGGTAATTTG intron_variant Intron 54 of 62 ENST00000675843.1 NP_000042.3 Q13315A0A024R3C7

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ATMENST00000675843.1 linkc.7928-3_7928-2insGTAATTTGTCCCTACTATGGAAATTAAG splice_acceptor_variant, intron_variant Intron 53 of 62 NM_000051.4 ENSP00000501606.1 Q13315

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
30
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Ataxia-telangiectasia syndrome Uncertain:2
Apr 11, 2025
Natera, Inc.
Significance:Uncertain significance
Review Status:no assertion criteria provided
Collection Method:clinical testing

- -

Dec 11, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with ATM-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This sequence change duplicates the last 20 nucleotides of exon 54 and the first 8 nucleotides of intron 54 (c.7991_8010+8dup). This results in the insertion of 28 nucleotides in intron 54, which is not expected to change the encoded amino acid sequence of the ATM protein. However, it generates a duplicated 5' consensus splice site in the intron. Algorithms developed to predict the effect of sequence changes on mRNA splicing suggest that this variant does not alter RNA splicing at the original consensus splice site. However, it may alter RNA splicing through the duplicated consensus splice site. This prediction has not been confirmed by published transcriptional studies. -

Hereditary cancer-predisposing syndrome Uncertain:1
Apr 11, 2025
Ambry Genetics
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.7991_8010+8DUP28 variant results from a duplication of 28 nucleotides between positions 7991 and 8010+8 and involves the canonical splice donor site after coding exon 53 of the ATM gene. The canonical splice donor site is highly conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will result in the creation of a novel splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
4.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555126295; hg19: chr11-108204672; API