NM_000059.4:c.2884_2908delCATATAAAAATGACTCTAGGTCAAG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000059.4(BRCA2):c.2884_2908delCATATAAAAATGACTCTAGGTCAAG(p.His962IlefsTer2) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. H962H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene BRCA2 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000059.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- BRCA2-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast-ovarian cancer, familial, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- Fanconi anemia complementation group D1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- pancreatic cancer, susceptibility to, 2Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- medulloblastomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000059.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | MANE Select | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | NP_000050.3 | A0A7P0T9D7 | ||
| BRCA2 | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | NP_001419006.1 | A0A7P0T9D7 | |||
| BRCA2 | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | NP_001393649.1 | A0A8V8TPZ2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | TSL:5 MANE Select | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | ENSP00000369497.3 | P51587 | ||
| BRCA2 | TSL:1 | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | ENSP00000439902.1 | P51587 | ||
| BRCA2 | TSL:1 | c.2515_2539delCATATAAAAATGACTCTAGGTCAAG | p.His839IlefsTer2 | frameshift | Exon 11 of 27 | ENSP00000499438.2 | A0A590UJI7 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at