chr13-32337236-CAGCATATAAAAATGACTCTAGGTCA-C
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000059.4(BRCA2):c.2884_2908delCATATAAAAATGACTCTAGGTCAAG(p.His962IlefsTer2) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. H962H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000059.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- BRCA2-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast-ovarian cancer, familial, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- Fanconi anemia complementation group D1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- pancreatic cancer, susceptibility to, 2Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- medulloblastomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000059.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | MANE Select | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | NP_000050.3 | A0A7P0T9D7 | ||
| BRCA2 | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | NP_001419006.1 | A0A7P0T9D7 | |||
| BRCA2 | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | NP_001393649.1 | A0A8V8TPZ2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | TSL:5 MANE Select | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | ENSP00000369497.3 | P51587 | ||
| BRCA2 | TSL:1 | c.2884_2908delCATATAAAAATGACTCTAGGTCAAG | p.His962IlefsTer2 | frameshift | Exon 11 of 27 | ENSP00000439902.1 | P51587 | ||
| BRCA2 | TSL:1 | c.2515_2539delCATATAAAAATGACTCTAGGTCAAG | p.His839IlefsTer2 | frameshift | Exon 11 of 27 | ENSP00000499438.2 | A0A590UJI7 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at