NM_000059.4:c.71_96delTAGGACCAATAAGTCTTAATTGGTTT

Variant names:

• chr13-32319077-ATTTAGGACCAATAAGTCTTAATTGGT-A
• rs80359637
• NM_000059.4:c.71_96delTAGGACCAATAAGTCTTAATTGGTTT

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000059.4(BRCA2):​c.71_96delTAGGACCAATAAGTCTTAATTGGTTT​(p.Leu24fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L24L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: BRCA2 NM_000059.4 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:4
• Conservation: PhyloP100: 7.06
• Publications: 4 publications found

Genes affected

BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

BRCA2 Gene-Disease associations (from GenCC):

• breast-ovarian cancer, familial, susceptibility to, 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
• Fanconi anemia complementation group D1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• pancreatic cancer, susceptibility to, 2

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• medulloblastoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 5132 pathogenic variants in the truncated region.
• PP5: Variant 13-32319077-ATTTAGGACCAATAAGTCTTAATTGGT-A is Pathogenic according to our data. Variant chr13-32319077-ATTTAGGACCAATAAGTCTTAATTGGT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 125993.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000059.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA2	NM_000059.4	MANE Select	c.71_96delTAGGACCAATAAGTCTTAATTGGTTT	p.Leu24fs	frameshift	Exon 3 of 27	NP_000050.3
	BRCA2	NM_001432077.1		c.71_96delTAGGACCAATAAGTCTTAATTGGTTT	p.Leu24fs	frameshift	Exon 3 of 27	NP_001419006.1
	BRCA2	NM_001406720.1		c.71_96delTAGGACCAATAAGTCTTAATTGGTTT	p.Leu24fs	frameshift	Exon 3 of 27	NP_001393649.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA2	ENST00000380152.8	TSL:5 MANE Select	c.71_96delTAGGACCAATAAGTCTTAATTGGTTT	p.Leu24fs	frameshift	Exon 3 of 27	ENSP00000369497.3
	BRCA2	ENST00000544455.6	TSL:1	c.71_96delTAGGACCAATAAGTCTTAATTGGTTT	p.Leu24fs	frameshift	Exon 3 of 27	ENSP00000439902.1
	BRCA2	ENST00000614259.2	TSL:2	n.71_96delTAGGACCAATAAGTCTTAATTGGTTT		non_coding_transcript_exon	Exon 2 of 26	ENSP00000506251.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: reviewed by expert panel

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:3

Dec 30, 1999

Breast Cancer Information Core (BIC) (BRCA2)

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

Sep 08, 2016

Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: curation

Variant allele predicted to encode a truncated non-functional protein.

Nov 26, 2014

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com.

Hereditary cancer-predisposing syndrome Pathogenic:1

Jul 09, 2016

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.71_96del26 pathogenic mutation, located in coding exon 2 of the BRCA2 gene, results from a deletion of 26 nucleotides at nucleotide positions 71 to 96, causing a translational frameshift with a predicted alternate stop codon (p.L24*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.1
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs80359637; hg19: chr13-32893214;