rs80359637

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000059.4(BRCA2):​c.71_96delTAGGACCAATAAGTCTTAATTGGTTT​(p.Leu24fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★).

Frequency

Genomes: not found (cov: 33)

Consequence

BRCA2
NM_000059.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:4

Conservation

PhyloP100: 7.06
Variant links:
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 1474 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-32319077-ATTTAGGACCAATAAGTCTTAATTGGT-A is Pathogenic according to our data. Variant chr13-32319077-ATTTAGGACCAATAAGTCTTAATTGGT-A is described in ClinVar as [Pathogenic]. Clinvar id is 125993.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr13-32319077-ATTTAGGACCAATAAGTCTTAATTGGT-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA2NM_000059.4 linkc.71_96delTAGGACCAATAAGTCTTAATTGGTTT p.Leu24fs frameshift_variant Exon 3 of 27 ENST00000380152.8 NP_000050.3 P51587

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA2ENST00000380152.8 linkc.71_96delTAGGACCAATAAGTCTTAATTGGTTT p.Leu24fs frameshift_variant Exon 3 of 27 5 NM_000059.4 ENSP00000369497.3 P51587
BRCA2ENST00000530893 linkc.-299_-274delTAGGACCAATAAGTCTTAATTGGTTT 5_prime_UTR_variant Exon 3 of 27 1 ENSP00000499438.2 A0A590UJI7
BRCA2ENST00000614259.2 linkn.71_96delTAGGACCAATAAGTCTTAATTGGTTT non_coding_transcript_exon_variant Exon 2 of 26 2 ENSP00000506251.1 A0A7P0TAP7

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:4
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:3
Dec 30, 1999
Breast Cancer Information Core (BIC) (BRCA2)
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: clinical testing

- -

Nov 26, 2014
Counsyl
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: literature only

- -

Sep 08, 2016
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Significance: Pathogenic
Review Status: reviewed by expert panel
Collection Method: curation

Variant allele predicted to encode a truncated non-functional protein. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Jul 09, 2016
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.71_96del26 pathogenic mutation, located in coding exon 2 of the BRCA2 gene, results from a deletion of 26 nucleotides at nucleotide positions 71 to 96, causing a translational frameshift with a predicted alternate stop codon (p.L24*). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs80359637; hg19: chr13-32893214; API