NM_000092.5:c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000092.5(COL4A4):c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG(p.Phe306fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000315 in 1,585,214 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000092.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive Alport syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, G2P, Orphanet, Ambry Genetics, Myriad Women’s Health
- Alport syndromeInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- hematuria, benign familial, 1Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- autosomal dominant Alport syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| COL4A4 | ENST00000396625.5 | c.914_930+29delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG | p.Phe306fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 15 of 48 | 5 | NM_000092.5 | ENSP00000379866.3 | ||
| COL4A4 | ENST00000643379.1 | c.*26_*71delGATTTCCAGGGCCTCGGGTAAGCATCATTTGCTGTTAACATCAGTG | downstream_gene_variant | ENSP00000494516.1 |
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152174Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome AF: 0.00000140 AC: 2AN: 1433040Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 715150 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.0000197 AC: 3AN: 152174Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2AN XY: 74350 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
not provided Pathogenic:5
- -
- -
This variant results in the deletion of part of exon 15 (c.914_930+29del) of the COL4A4 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in COL4A4 are known to be pathogenic (PMID: 21196518, 24854265, 25307543). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with clinical features of Alport syndrome (PMID: 9792860; internal data). It has also been observed to segregate with disease in related individuals. This variant is also known as 1122del46bp. ClinVar contains an entry for this variant (Variation ID: 447196). For these reasons, this variant has been classified as Pathogenic. -
Canonical splice site variant predicted to result in in-frame deletion within a critical region. Variant damages or destroys the canonical splice donor site in intron 15, and is expected to cause abnormal gene splicing; if the splice outcome is exon skip, the loss of the encoded residues in the triple helical region is expected to disrupt normal protein folding and function; Not observed in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 9792860) -
- -
Autosomal recessive Alport syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at